Single base polymorphism in the human Tumour Necrosis Factor alpha (TNFα) gene detectable by <i>Ncol</i> restriction of PCR product

Wilson, AG; Giovine, F. S. Di; Blakemore, Alexandra I. F.; Duff, G. W.

doi:10.1093/hmg/1.5.353

Cited by 837 publications

(547 citation statements)

References 0 publications

Supporting

Mentioning

523

Contrasting

Unclassified

Order By: Relevance

“…Therefore, attention has focused on the TNF promoter, encouraged by the identification of a number of singlenucleotide polymorphisms (SNPs). Eight DNA variants or 'SNPs' have been described within the TNF promoter, at positions À1031T/C, À863C/A, À857C/T, À575G/A, À376G/A, À308G/A, À244G/A, and À238G/A [10][11][12][13][14][15][16] relative to the transcription start site (Figure 1). The interest in these genetic variants derives from the possibility that the genetic changes they introduce, in comparison to the common form, could affect the binding of transcription factors, controlling the activity of the promoter and resulting mRNA and protein levels.…”

Section: Introductionmentioning

confidence: 99%

Is there a future for TNF promoter polymorphisms?

2004

View full text Add to dashboard Cite

The in vitro study of TNF promoter polymorphism (SNP) function was stimulated by the numerous case-control (association) studies of the polymorphisms in relation to human disease and the appearance of several studies claiming to show a functional role for these SNPs provided a further impetus to researchers interested in the role of TNF in their disease of interest. In this review we consider case-control studies, concentrating on the autoimmune and inflammatory diseases rheumatoid arthritis, multiple sclerosis, ankylosing spondylitis, and asthma, and on infectious diseases including malaria, hepatitis B and C infection, leprosy and sepsis/septic shock. We also review the available evidence on the functional role of the various TNF promoter polymorphisms. In general, case-control studies have produced mixed results, with little consensus in most cases on whether any TNF polymorphisms are actually associated with disease, although results have been more consistent in the case of infectious diseases, particularly malaria. Functional studies have also produced mixed results but recent work suggests that the much studied À308G/A polymorphism is not functional, while the function of other TNF polymorphisms remains controversial. Studies of the TNF region are increasingly using extended haplotypes that can better capture the variation of the MHC region.

show abstract

Section: Introductionmentioning

confidence: 99%

Is there a future for TNF promoter polymorphisms?

2004

View full text Add to dashboard Cite

show abstract

“…The sequence is numbered in relation to the transcription start site (+ 1). The TATA boxes are underlined and the arrowed lines are indicated as the two oligonucleotide primers for PCR amplification (from --332 to --226) (Wilson et al, 1992). The polymorphism at position --308 is indicated by a triangle.…”

Section: Resultsmentioning

confidence: 99%

“…For TNFA, following primers were used: 5"AGGCAATAGG-TTTTGAGGGCCAT3' (TNFAI), and 5"TCCTCCCTGCTCCGATTCCG3" (TNFA2) which were hybridized to positions of --332 to -310 and of --245 to --226 of the TNFA gene ( Fig. 1) (Wilson et al, 1992).…”

Section: Methodsmentioning

confidence: 99%

“…Moreover, the DNA sequences determine a phenotype. A polymorphism in TNFA gene is determined not only by direct sequencing (Messer et al, 1991) but also by other methods: i.e., polymerase chain reaction NeoI restriction fragment length polymorphism (PCR-NcoI-RFLP) typing (Wilson et al, 1992), polymerase chain reaction single strand conformational polymorphism typing (PCR-SSCP) (Wilson et al, 1993), and polymerase chain reaction allele specific oligonucleotide typing (PCR-ASO) (D'Alfonso and Richiardi, 1994). We applied the PCR-NcoI-RFLP method to screen polymorphic variations at position --308 of the TNFA promoter in unrelated Korean individuals.…”

Section: Introductionmentioning

confidence: 99%

“…Wilson et al (1992) showed that the mendelian segregation of this polymorphism was observed in 5 members of one family spanning two generations.…”

mentioning

confidence: 97%

See 2 more Smart Citations

NcoI restriction fragment length polymorphism at — 308 of the tumor necrosis factor alpha (TNFA) promoter region in korean

Park

Kim²,

Mok

1997

Jap J Human Genet

View full text Add to dashboard Cite

SummaryTumor necrosis factor alpha (TNFA) is a cytokine, which is secreted from activated macrophage, with a broad range of biological activities. The gene encoding TNFA is located in tandem with the TNFB gene within the HLA complex on chromosome 6p21.3. We detected a single base polymorphism in the human TNFA gene promoter region in 300 unrelated Korean individuals. The TNFA promoter region which showed a G to A transition at position of -308 was investigated by NcoI restriction fragment length polymorphism analysis. A biallelic polymorphism of TNFA gene showed fragments of 87/20 bp and 107 bp acting as TNFA* 1 allele and TNFA*2 allele, respectively. The allele frequencies of TNFA* 1 and TNFA* 2 were 0.8783 and 0.1217, respectively. The 21.7% of heterozygosity was observed. No association between promoter region phenotypes of TNFA and the first intron phenotypes of TNFB was observed in Korean. Allele frequencies of Koreans were compared with that of Europeans.

show abstract