SIVMAC Vpx improves the transduction of dendritic cells with nonintegrative HIV-1-derived vectors

Berger, Grégory; Goujon, Caroline; Jl, Darlix; Cimarelli, Andrea

doi:10.1038/gt.2008.128

Cited by 36 publications

(33 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…FL vDNA was measured with oligonucleotides specific to the gfp gene that was carried by all viruses (GAACGGCATCAAG GTGAACT and TGCTCAGGTAGTGGTTGTCG). Integrated vDNA was measured according to an already-established procedure (59). Briefly, an initial PCR was carried out for 20 cycles using the GFP upstream oligonucleotide mentioned above, along with an Alu-specific oligonucleotide (C CTCCCAAAGTGCTGGGAT).…”

Section: Methodsmentioning

confidence: 99%

Evidence for a Different Susceptibility of Primate Lentiviruses to Type I Interferons

Cordeil

Nguyen

Berger

et al. 2013

J Virol

View full text Add to dashboard Cite

Type I interferons induce a complex transcriptional program that leads to a generalized antiviral response against a large panel of viruses, including human immunodeficiency virus type 1 (HIV-1). However, despite the fact that interferons negatively regulate HIV-1 ex vivo, a chronic interferon state is linked to the progression of AIDS and to robust viral replication, rather than protection, in vivo. To explain this apparent contradiction, we hypothesized that HIV-1 may have evolved a partial resistance to interferon, and to test this hypothesis, we analyzed the effects of alpha interferon (IFN-␣) on the infectivity of HIV-1, human immunodeficiency virus type 2 (HIV-2), and rhesus monkey simian immunodeficiency virus (SIVmac). The results we obtained indicate that HIV-1 is more resistant to an IFN-␣-induced response than are HIV-2 and SIVmac. Our data indicate that the accumulation of viral DNA is more compromised following the infection of IFN-␣-treated cells with HIV-2 and SIVmac than with HIV-1. This defect correlates with a faster destabilization of HIV-2 viral nucleoprotein complexes (VNCs), suggesting a link between VNC destabilization and impaired viral DNA (vDNA) accumulation. The differential susceptibilities to IFN-␣ of the primate lentiviruses tested here do not map to the capsid protein (CA), excluding de facto a role for human tripartite motif protein isoform 5 alpha (Trim5␣) in this restriction; this also suggests that an additional restriction mechanism differentially affects primate lentivirus infection. The different behaviors of HIV-1 and HIV-2 with respect to IFN-␣ responses may account at least in part for the differences in pathogenesis observed between these two virus types.

show abstract

Section: Methodsmentioning

confidence: 99%

Evidence for a Different Susceptibility of Primate Lentiviruses to Type I Interferons

Cordeil

Nguyen

Berger

et al. 2013

J Virol

View full text Add to dashboard Cite

show abstract

“…This mutation is present within the catalytic site of the enzyme and results in an integration-defective virus (8,32).…”

Section: Cellsmentioning

confidence: 99%

Characterization of the Behavior of Functional Viral Genomes during the Early Steps of Human Immunodeficiency Virus Type 1 Infection

Arfi

Lienard

Nguyen

et al. 2009

J Virol

View full text Add to dashboard Cite

Infectious viral DNA constitutes only a small fraction of the total viral DNA produced during retroviral infection, and as such its exact behavior is largely unknown. In the present study, we characterized in detail functional viral DNA produced during the early steps of human immunodeficiency virus type 1 infection by analyzing systematically their kinetics of synthesis and integration in different target cells. In addition, we have compared the functional stability of viral nucleoprotein complexes arrested at their pre-reverse transcription state, and we have attempted to measure the kinetics of loss of capsid proteins from viral complexes through the susceptibility of the early phases of infection to cyclosporine, a known inhibitor of the interaction between viral capsid and cyclophilin A. Overall, our data suggest a model in which loss of capsid proteins from viral complexes and reverse transcription occur concomitantly and in which the susceptibility of target cells to infection results from a competition between the ability of the cellular environment to quickly destabilize viral nucleoprotein complexes and the capability of the virus to escape such targeting by engaging the reverse transcription reaction.

show abstract

“…Vpx-containing VLP were also found to promote the transduction of DC with episomal lentiviral vectors by increasing the number of cells infected and the level of transgene expression (9). The effect of Vpx could be partially mimicked by treating the DC with the proteasome inhibitor MG132, suggesting that Vpx allows the virus to escape a degradative pathway operative in these cells (18).…”

mentioning

confidence: 99%

Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx

Gramberg

Sunseri

Landau

2010

J Virol

View full text Add to dashboard Cite

SIVMAC Vpx improves the transduction of dendritic cells with nonintegrative HIV-1-derived vectors

Cited by 36 publications

References 21 publications

Evidence for a Different Susceptibility of Primate Lentiviruses to Type I Interferons

Evidence for a Different Susceptibility of Primate Lentiviruses to Type I Interferons

Characterization of the Behavior of Functional Viral Genomes during the Early Steps of Human Immunodeficiency Virus Type 1 Infection

Evidence for an Activation Domain at the Amino Terminus of Simian Immunodeficiency Virus Vpx

Contact Info

Product

Resources

About