Slow Overmethylation of Housekeeping Genes in the Body Mucosa Is Associated with the Risk for Gastric Cancer

Abstract

Helicobacter pylori infection increases age-related diverse overmethylation in gene-control regions, which increases the risk of gastric cancer. The H. pylori-associated overmethylation changes subsequently disappear when gastric atrophy and cancer develop. To identify cancer-risk epigenotypes, we traced dynamic methylation changes in the background mucosa of the stomach depending on the extent of gastric atrophy. Paired biopsy specimens were obtained from the noncancerous antrum and body mucosa of 102 patients with cancer and 114 H. pylori-positive and 112 H. pylori-negative controls. The grade of gastric atrophy was evaluated using the endoscopic atrophic border score. The methylation-variable sites at the CpG-island margins and near the transcriptional start sites lacking CpG islands were semiquantitatively analyzed by radioisotope-labeling methylation-specific PCR. We selected eight housekeeping genes adjacent to Alu (CDH1, ARRDC4, PPARG, and TRAPPC2L) or LTR retroelements (MMP2, CDKN2A, RUNX2, and RUNX3) and eight stomach-specific genes (TFF2, PGC, ATP4B, TFF1, TFF3, GHRL, PGA, and ATP4A). Analysis of agerelated methylation in the H. pylori-positive controls revealed slow overmethylation in the body and in the LTR-adjacent genes. A high-frequency overmethylation defined based on the slowly overmethylated genes was frequently observed in the body of patients with gastric cancer with open-type atrophy (OR, 12.7; 95% confidence interval, 3.2-49.8). The rapidly changing methylation of Alu-adjacent genes was barely increased in the antrum of patients with gastric cancer. Among diverse methylation changes associated with H. pylori infection, an increase in slowly changing methylation could serve as a cancer-risk marker. Cancer Prev Res; 7(6); 585-95. Ó2014 AACR.

DNA Methylation Predicts Progression of Human Gastric Lesions

“…Germline inactivation of CDH1, which encodes E-cadherin, is associated with high risk for hereditary diffuse gastric cancer. The site we examined in the CDH1 promoter was previously reported in a cross-sectional study to show methylation changes in the non-malignant antrum adjacent to gastric cancers(23). We also added AMPH and SORCS3, which had been identified from a screen of 14,495 genes, as hypermethylated in both Epstein Barr virus-associated gastric cancers and in uninfected tumors (22).…”

“…Pyrosequencing primers for AMPH and SORCS3 were as described in Matsusaka et al(22). Other primer sequences were as follows: for CDH1 : (F) GGTTGTGGTAGGTAGGTGAAT, (R) biotin-AACTTCCCCAAACTCACAAATACTTTAC, (Seq) GTAGGTGAATTTTTAGTTAATTAG, from Oh et al (23); for CDKN2A : (F) TTAGAGGATTTGAGGGATAGGG, (R) biotin-CCCTACCTACTCTCCCCCTCTC, (Seq) GTTGGTTGGTTATTAG; for EMX1 : (F) GTGGGGTTTAGTTTGTTGTATTAAGA, (R) biotin-ATCCCCACCAAACCTCTAAACT, (Seq) TTGAGATTAGGTTTTTTAGAA; for NKX6-1 : (F) GGTTTGGGTGAGTTTATTGAAGATAGT, (R) biotin-CAACCTATACCAACCCCCAAAAT, (Seq) TAGTTTAGAGTTTTTAGGGTAG. Sites of noncommercial assays are shown in Table 1, and maps of CpG locations are shown in Supplementary Figure S1.…”

Trefoil factors: Gastrointestinal-specific proteins associated with gastric cancer

“…However, several studies have shown that TFF2 expression was down-regulated pronouncedly in GC compared with the associated normal tissue and promoter hypermethylation at the CpG sites was found to regulate the reduction of TFF2 expression [25,38,76,[83][84][85]. In addition, Oh et al [86] reported that TFF2 gene lacking CpG islands tended to be frequently overmethylated in cancer patients compared with Hp-positive controls. Strikingly increased expression of TFF2 was noted in the diffuse type and advanced stage tumors [82].…”

Genetic Alterations in Gastric Cancer Associated with Helicobacter pylori Infection

“…Thus, it represents an objective diagnosis and a potential therapy for gastric cancer. H. pylori infection contributes to the loss of expression of the transcription factor related Runt-3 (RUNX3) in gastric cancer through its overmethylation (69). …”