Small cytosolic double-stranded DNA represses cyclic GMP-AMP synthase activation and induces autophagy

Liu, Yao; Xiao, Chen; Zhao, Yuemei; Wang, Xingyue; Luo, Yang; Chen, Lina; Wang, Weiyun; Zhong, Shouhui; Hu, Menglan; Dai, Zhizheng; Jiang, Jiayu; X, Wang; Ji, Hongyu; Cheng, Xiaoxiao; Zheng, Anqi; Zuo, Jiwei; Liu, Hui; Ma, Dawei; Luo, Zhicheng; Cao, Fengming; Hu, Shanshan; Huang, Aiping; Tang, Kai-Fu

doi:10.1016/j.celrep.2023.112852

Cited by 9 publications

(8 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The lack of robust cGAS expression may reduce pathogen-derived DNA sensing in adult cardiomyocytes, similar to hepatocytes that also lack functional cGAS-STING 78 . Many reports suggest an association between DNA damage and cGAS-STING activation 27,[79][80][81][82] . Our data that Lmna CKO cardiomyocytes accumulate DNA damage without activating cGAS-STING suggest that DNA damage and cGAS-STING can be uncoupled.…”

Section: Discussionmentioning

confidence: 99%

Pervasive nuclear envelope ruptures precede ECM signaling and disease onset without activating cGAS-STING in Lamin-cardiomyopathy mice

En,

Bogireddi,

Thomas

et al. 2023

Preprint

View full text Add to dashboard Cite

Mutations in the nuclear Lamin A/C gene (LMNA) cause diverse degenerative disorders, including malignant dilated cardiomyopathy in adults. A prevailing hypothesis postulates thatLMNAmutations cause nuclear envelope ruptures that trigger pathogenic inflammatory signaling via the cGAS-STING cytosolic DNA-sensing pathway. Here, we provide evidence against this hypothesis, using a mouse model ofLMNA-related cardiomyopathy that mimics Lamin A/C protein reduction observed in patient cardiomyocytes. We observed that pervasive nuclear envelope ruptures preceded the onset of cardiac transcriptional modulation and dilated cardiomyopathy. Nuclear ruptures activated DNA damage response without causing immediate cardiomyocyte death. However, cGAS-STING downstream cytokine genes remained inactive in the mutant cardiomyocytes. DeletingcGasorStingdid not alleviate cardiomyopathy. Instead, extracellular matrix signaling was predicted to emanate from Lamin A/C-reduced cardiomyocytes to communicate with fibroblasts in the heart. These findings suggest that cGAS-STING is not a major pathogenetic contributor toLMNA-related dilated cardiomyopathy in adult humans.

show abstract

Section: Discussionmentioning

confidence: 99%

Pervasive nuclear envelope ruptures precede ECM signaling and disease onset without activating cGAS-STING in Lamin-cardiomyopathy mice

En,

Bogireddi,

Thomas

et al. 2023

Preprint

View full text Add to dashboard Cite

show abstract

“…Binding of cGAS to Beclin-1 leads to the release of Rubicon, thereby enabling autophagic degradation of cytosolic dsDNA and resulting in decreased cGAS-STING signaling ( Figure 3 ). Moreover, Beclin-1 also suppresses the NTase activity of cGAS to decrease the production of the secondary messenger cGAMP and type I IFN production ( 150 , 154 ).…”

Section: Interactions Of Autophagy With the Cgas-sting Pathwaymentioning

confidence: 99%

The interplay between autophagy and cGAS-STING signaling and its implications for cancer

Schmid,

Fischer,

Engl

et al. 2024

Front. Immunol.

View full text Add to dashboard Cite

Autophagy is an intracellular process that targets various cargos for degradation, including members of the cGAS-STING signaling cascade. cGAS-STING senses cytosolic double-stranded DNA and triggers an innate immune response through type I interferons. Emerging evidence suggests that autophagy plays a crucial role in regulating and fine-tuning cGAS-STING signaling. Reciprocally, cGAS-STING pathway members can actively induce canonical as well as various non-canonical forms of autophagy, establishing a regulatory network of feedback mechanisms that alter both the cGAS-STING and the autophagic pathway. The crosstalk between autophagy and the cGAS-STING pathway impacts a wide variety of cellular processes such as protection against pathogenic infections as well as signaling in neurodegenerative disease, autoinflammatory disease and cancer. Here we provide a comprehensive overview of the mechanisms involved in autophagy and cGAS-STING signaling, with a specific focus on the interactions between the two pathways and their importance for cancer.

show abstract

“…Functional analysis revealed that the scDNA inhibited cyclic GMP–AMP synthase (cGAS) activation by blocking the binding of long dsDNA to cGAS and inducing the autophagic degradation of long dsDNA and stimulator of interferon genes (STING). 1 …”

Section: Before You Beginmentioning

confidence: 99%

“… 1 N/A 15 bp antisense DNA marker AGATTAGAAGCGACC Liu et al. 1 N/A 40 bp sense DNA marker TTCTTCGTGCCACGTCC TGACTTCGTGCGTCACTTGGAAC Liu et al. 1 N/A 40 bp antisense DNA marker GTTCCAAGTGACGCACGAA GTCAGGACGTGGCACGAAGAA Liu et al.…”

Section: Key Resources Tablementioning

confidence: 99%

Protocol for isolating small cytosolic dsDNA from cultured murine cells

Dai,

Ji,

Zheng

et al. 2024

STAR Protocols

Self Cite

View full text Add to dashboard Cite

Small cytosolic double-stranded DNA represses cyclic GMP-AMP synthase activation and induces autophagy

Cited by 9 publications

References 43 publications

Pervasive nuclear envelope ruptures precede ECM signaling and disease onset without activating cGAS-STING in Lamin-cardiomyopathy mice

Pervasive nuclear envelope ruptures precede ECM signaling and disease onset without activating cGAS-STING in Lamin-cardiomyopathy mice

The interplay between autophagy and cGAS-STING signaling and its implications for cancer

Protocol for isolating small cytosolic dsDNA from cultured murine cells

Contact Info

Product

Resources

About