Small-molecule activation of the TRAIL receptor DR5 in human cancer cells

Abstract

A poptosis in mammalian cells is executed by the proteolytic activities of caspases that are activated in response to apoptotic stimuli via two distinct signaling pathways 1 . These pathways have different initiator caspases that cleave and activate a common set of executioner caspases, including caspases 3, 6 and 7. The intrinsic (or mitochondrial) pathway of apoptosis is activated in response to DNA damage and other stress signals within the cell. Cytochrome c is consequently released from mitochondria into the cytosol and binds its adaptor protein, Apaf-1, to form the large 'apoptosome' complex, which recruits and activates caspase-9 (ref. 2). The extrinsic pathway is triggered from the exterior of the cell by members of the TNF superfamily, which bind and activate their corresponding death receptors [3][4][5] . For example, binding of TRAIL to the extracellular domain (ECD) of the death receptors DR4 (TRAIL-Receptor 1 (TRAIL-R1)) and DR5 (TRAIL-R2) promotes clustering of these receptors. The ligand-receptor complex in turn engages the adaptor protein Fas-associated death domain (FADD) via its cytoplasmic death domains. FADD then recruits the initiator caspase-8 through its N-terminal death-effector domain to form a death-inducing signaling complex (DISC) [6][7][8][9] .Caspase activation is tightly regulated by members of the inhibitor of apoptosis protein (IAP) family, such as XIAP, cIAP1 and cIAP2 (refs. 10-12). In response to death signals, a second mitochondriaderived activator of apoptosis (Smac; also called Diablo) is released from the mitochondria into the cytosol, where it binds the Bir domains of XIAP to relieve its inhibition of caspases and the Bir domains of cIAPs to induce their degradation. The four N-terminal residues (alanine, valine, proline and isoleucine) of Smac are sufficient for this interaction and have been mimicked using a peptidomimetic approach to generate cell-permeable small molecules that function similarly to the Smac protein [13][14][15] . Previously, we demonstrated that Smac mimetics not only effectively kill cancer cell lines with an autocrine TNFα signal but also substantially increase the cell-killing efficiency of TRAIL [13][14][15] .Selective activation of the apoptotic pathway provides tremendous therapeutic potential for cancer treatment 16 . Various strategies are currently under active clinical investigation, including the use of Bcl-2 inhibitors, Smac mimetics or IAP antagonists and deathreceptor agonists 17 . Among the death receptor-targeted agents, the therapeutic use of TNFα and agonistic CD95-specific antibodies has been hampered by their toxic side effects, particularly a severe inflammatory response through NF-κB activation 3,18 . However, mounting evidence from clinical trials has indicated that targeting DR4 and DR5 with agonist antibodies or recombinant TRAIL selectively eliminates tumor cells while sparing normal cells 19,20 . Although targeting TRAIL pathways may be promising as a safe anticancer therapy, the clinical use of TRAIL itself is limited by it...

Neddylation Inhibition Activates the Extrinsic Apoptosis Pathway through ATF4–CHOP–DR5 Axis in Human Esophageal Cancer Cells

“…Death receptor-mediated (extrinsic) apoptosis represents one of the most important cytotoxic pathways activated by anticancer agents (11,27,(41)(42)(43)(44). In this study, we demonstrated, to our knowledge for the first time, that neddylation inhibition with MLN4924 induces DR5-mediated apoptosis in ESCC cells.…”

“…Moreover, we found that DR5-mediated apoptosis is ligand-independent since downregulation of its cognate ligand TRAIL failed to rescue DR5-induced apoptosis. Similarly, it is reported that unmitigated ER stress induced CHOP-mediated DR5 transcription and CASP8-mediated apoptosis in a TRAIL-independent manner (27,45). In addition, extrinsic apoptosis induced by MLN4924 in turn triggered intrinsic apoptosis through the CASP8/tBid axis.…”

“…The sequences of the siRNA are as follows: siCASP9 (27): GAUGC-CUGGUUGCUUUAAU; siCASP8 (27): UGGAUUUGCUGAU-UACCUA; siNoxa (28): GUAAUUAUUGACACAUUUC; siBid (29): AAGAAGACAUCAUCCGGAAUA; siDR5 (30): AAGACC-CUUGUGCUCGUUGUC; siCHOP (31): GCCUGGUAUGAG-GACCUGC; siATF4 (31): GCCUAGGUCUCUUAGAUGA; siUBA3 (2): CUGCCUGGAAUGACUGCUUAA; siNAE1 (10): GGGUU-GUGCUUUAGUCUGU; and siTRAIL (27): CAAGUUAUCCUG-ACCCUAU.…”

Molecular Pathways: Targeting Death Receptors and Smac Mimetics

“…Furthermore, the Smac mimetic compound 3 and TRAIL were shown to synergistically induce caspase activation and apoptosis in glioblastoma cells (19). Recently, small molecules were identified that target TRAIL-R2 and interact with Smac mimetics to induce apoptosis in glioblastoma cells (20).…”

Topology and biological function of enterovirus non-structural protein 2B as a member of the viroporin family

“…This process is achieved via the following two pathways: (1) exogenous pathway, where stimuli activate the death receptors Fas or CD95 on the cell surface; and (2) endogenous pathway, where increased permeability of the mitochondrial membrane and ER stress occurs [32]. In the mitochondrial pathway, the permeability of the mitochondrial membrane increases.…”