Small RNA and Degradome Sequencing Reveal Important MicroRNA Function in Nicotiana tabacum Response to Bemisia tabaci

Abstract

MicroRNAs (miRNAs), a class of small non-coding regulatory RNAs, are key molecules in many biological and metabolic processes of plant growth, development and stress response via targeting mRNAs. The phloem-feeding insect whitefly Bemisia tabaci (Hemiptera, Aleyrodidae) is a serious pest that causes devastating harm to agricultural production worldwide. However, the function of host miRNAs in the response to whitefly infestation remains unclear. Here, we sequenced the small RNA and degradome of tobacco (Nicotiana tabacum L.), after and before infestation by B. tabaci. We identified 1291 miRNAs belonging to 138 miRNA families including 706 known miRNAs and 585 novel miRNAs. A total of 47 miRNAs were differentially expressed, of which 30 were upregulated and 17 were downregulated by whitefly exposure. Then, computational analysis showed that the target genes of differential miRNAs were involved in R gene regulation, plant innate immunity, plant pathogen defense, the plant hormone signal pathway and abiotic stress tolerance. Furthermore, degradome analysis demonstrated that 253 mRNAs were cleaved by 66 miRNAs. Among them, the targets cleaved by upregulated miR6025, miR160, miR171, miR166 and miR168 are consistent with our prediction, suggesting that pathogen-related miRNAs may function in plant defense against whitefly. Moreover, our results show that plant miRNA response and miRNA-mediated post-transcriptional regulation for phloem-feeding insect infestation are similar to pathogen invasion. Our study provides additional data to further elucidate how host plants respond and defend the phloem-feeding insects.

Herbivore insect small RNA effector suppress plant defense by cross-kingdom gene silencing

“…Whitefly salivary miR29-b is secreted into plants during feeding Previously, we have identified and analyzed miRNAs in tobacco plants infested by whiteflies (22). To identify potential whitefly miRNA effectors, we co-analyzed the miRNAs in tobacco plants and the whitefly miRNA database.…”

“…Total RNAs were extracted from whitefly samples using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Small RNA sequencing was performed as previously described ( 22 ). Purified RNA fragments were ligated to two adaptors (5’ adaptor: GTTCAGAGTTCTACAGTCCGACGATC; 3’ adaptor: TGGAATTCTCGGGTGCCAAGG) and converted to complementary DNA (cDNA) for RT-PCR amplification.…”

“…Degradome sequencing analysis, following the previous study ( 22 ), was commissioned to Lianchuan Biotechnology Co., Ltd. to conduct.…”

Advances in molecular plant pathology, plant abiotic and biotic stress

“…For example, strains of X. albilineans belonging to different serovars varied in pathogenicity based on multiplication of the pathogen in sugarcane varieties (Mohamed et al, 1996). High variation in disease severity (DS) among strains of X. albilineans was found in Australia, Brazil, Guadeloupe, Mexico, and in the Guangxi province of China (Persley, 1973;Champoiseau et al, 2006b;Huerta-Lara et al, 2009;Tardiani et al, 2014;Wu et al, 2022). Notably, significant strain effects and variety × strain interactions were observed for strains originating from different countries (Mohamed et al, 1996).…”

Overexpression of Nta-miR6155 confers resistance to Phytophthora nicotianae and regulates growth in tobacco (Nicotiana tabacum L.)

“…MicroRNAs (miRNAs) play important roles in regulating plant growth and development and stress response by shearing target messengerRNAs (mRNAs) genes or inhibiting the translation of target mRNAs ( Zhu et al., 2020 ; Han and Wang, 2022 ). In recent years, many miRNAs have been discovered through miRNA sequencing ( Evers et al., 2015 ), and the biosynthesis, mechanism of action, and functions of plant miRNAs have gradually been revealed ( Song et al., 2019 ; Li and Yu, 2021 ).…”