Smooth Muscle Progenitor Cells Derived From Human Pluripotent Stem Cells Induce Histologic Changes in Injured Urethral Sphincter

Li, Yanhui; Wen, Yan; Wang, Zhe; Yi, Wei; Wani, Prachi; Green, Morgaine; Swaminathan, Ganesh; Ramamurthi, Anand; Pera, Renee Reijo; Chen, Bertha

doi:10.5966/sctm.2016-0035

Cited by 22 publications

(34 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Previous studies have observed significant changes in elastin and collagen content in the periurethral tissues of SUI women [50]. Consistent with these published data from human tissues, studies from our lab and others have showed that the protein level of elastin significantly decreased in lower urinary tract of SUI rats [28,51]. However, after treatment with MACS-sorted pSMCs, the tissue content of elastin in the lower urinary tract significantly increased, suggesting that, in addition to cell integration, elastin deposition in the damaged rat lower urinary tract may also contribute to the therapeutic effect of MACS-sorted pSMCs.…”

Section: Discussionsupporting

confidence: 90%

Efficacy and Safety of Immuno-Magnetically Sorted Smooth Muscle Progenitor Cells Derived from Human-Induced Pluripotent Stem Cells for Restoring Urethral Sphincter Function

Green

Wen

et al. 2017

Stem Cells Translational Medicine

Self Cite

View full text Add to dashboard Cite

Human‐induced pluripotent stem cells (hiPSCs)‐based cell therapy holds promise for treating stress urinary incontinence (SUI). However, safety concerns, especially tumorgenic potential of residual undifferentiated cells in hiPSC derivatives, are major barriers for its clinical translation. An efficient, fast and clinical‐scale strategy for purifying committed cells is also required. Our previous studies demonstrated the regenerative effects of hiPSC‐derived smooth muscle progenitor cells (pSMCs) on the injured urethral sphincter in SUI, but the differentiation protocol required fluorescence‐activated cell sorting (FACS) which is not practical for autologous clinical applications. In this study, we examined the efficacy and safety of hiPSC‐derived pSMC populations sorted by FDA‐approved magnetic‐activated cell sorting (MACS) using cell‐surface marker CD34 for restoring urethral sphincter function. Although the heterogeneity of MACS‐sorted pSMCs was higher than that of FACS‐sorted pSMCs, the percentage of undifferentiated cells dramatically decreased after directed differentiation in vitro. In vivo studies demonstrated long‐term cell integration and no tumor formation of MACS‐sorted pSMCs after transplantation. Furthermore, transplantation of MACS‐sorted pSMCs into immunodeficient SUI rats was comparable to transplantation with FACS‐sorted pSMCs for restoration of the extracellular matrix metabolism and function of the urethral sphincter. In summary, purification of hiPSC derivatives using MACS sorting for CD34 expression represent an efficient approach for production of clinical‐scale pSMCs for autologous stem cell therapy for regeneration of smooth muscle tissues. Stem Cells Translational Medicine 2017;6:1158–1167

show abstract

Section: Discussionsupporting

confidence: 90%

Efficacy and Safety of Immuno-Magnetically Sorted Smooth Muscle Progenitor Cells Derived from Human-Induced Pluripotent Stem Cells for Restoring Urethral Sphincter Function

Green

Wen

et al. 2017

Stem Cells Translational Medicine

Self Cite

View full text Add to dashboard Cite

show abstract

“…The rat model of SUI was established via transabdominal urethrolysis as described by Rodriguez et al [25]. This SUI rat model showed signi cantly decreased urethral resistance (by leak point pressure measurements) and urethral smooth muscle damage for at least 8 weeks after surgery [17,26]. Bilateral ovariectomy was done on the rodents to eliminate the in uence of estrus cycle on the ECM metabolism and to simulate an estrogen-de ciency state of menopause [27].…”

Section: In Vitro Treatment Of Human Bladder and Vaginal Cells With Pmentioning

confidence: 99%

“…Total RNA (1 µg) was reverse transcribed into cDNA using the M-MLV reverse transcriptase system (Thermo Scienti c). PCR primers were described previously [17,24], except human TIMP2 (Sense: AAGCGGTCAGTGAGAAGGAA; Anti-sense: GATGTTCAAAGGGCCTGAGA), rat MMP2 (Sense: GTAAAGTATGGGAACGCTGATGGC; Anti-sense: CTTCTCAAAGTTGTACGTGGTGGA) and rat TIMP2 (Sense: ACACGCTTAGCATCACCCAGAA; Anti-sense: CAGTCCATCCAGAGGCACTCAT The slides were visually scored by four people separately for elastin length (1 = short, 2 = moderate, 3 = long), thickness (1 = thin, 2 = moderate, 3 = thick) and density (1 = sparce, 2 = moderate density, 3 = dense), collagen density (1 = sparce, 2 = moderate density, 3 = dense). The scorers were blinded to the group assignments.…”

Section: Rna Extraction and Quantitative Reverse Transcriptionpolymermentioning

confidence: 99%

“…Our previous study documented that alteration of ECM components in the lower urinary tract after urethrolysis contribute to the development of urine incontinence in SUI rats [17]. To evaluate the effect of pSMC-CM on in vivo ECM remodeling in the lower urinary tract, we examined expression of collagen I, collagen III, elastin, TIMP-2 and MMP-2 in rat urethra and vagina.…”

Section: Psmc-cm Promoted Gene Expression Of Collagen and Elastin Inmentioning

confidence: 99%

“…Expansion of adult MSCs can be limited by availability, decreased proliferation, and cell senescence. Our previous study indicated that periurethral transplantation of hiPSCderived smooth muscle cell progenitors (pSMCs) promotes functional restoration of the injured rat urethra through pSMC engraftment into the tissues [17]. We also observed signi cant changes in the native rodent tissue extracellular matrix (ECM) in the pSMC transplanted urethras with a shift to increased elastin deposition rather than the stiff, collagenous tissue typical of chronic injury.…”

Section: Introductionmentioning

confidence: 98%

See 2 more Smart Citations

Secretomes of human pluripotent stem cell-derived smooth muscle cell progenitors upregulate extracellular matrix metabolism in the lower urinary tract and vagina

Zhuang

Wen

Briggs

et al. 2020

Preprint

Self Cite

View full text Add to dashboard Cite

Background: Adult mesenchymal stem cells (MSCs) have been studied extensively for regenerative medicine, however, they have limited proliferation in vitro, and the long culture time induces cell senescence. MSCs also contribute to tissue repair through their paracrine function. In this study, we sought to examine the paracrine effects of smooth muscle cell progenitors (pSMC) on the urethra and adjacent vagina of stress urinary incontinence rodents. We use human pluripotent stem cell (PSC) lines to derive pSMCs to overcome the issue of decreased proliferation and to obtain a homogenous cell population. This novel approach for treatment of urinary incontinence can also be expanded into treatments for other pelvic floor disorders. Method: Three human PSC lines were differentiated into pSMCs. The conditioned medium (CM) from pSMC culture, which contain pSMC secretomes, was harvested. To examine the effect of the CM on the extracellular matrix of the lower urinary tract, human bladder smooth muscle cells (bSMCs) and vaginal fibroblasts were treated with pSMC-CM in vitro. Stress urinary incontinence (SUI) was induced in rats by surgical injury of the urethra and adjacent vagina. SUI rats were treated with pSMC-CM and monitored for 5 weeks. Urethral pressure testing was performed prior to euthanasia, and tissues were harvested for PCR, Western Blot and histological staining. Kruskal-Wallis one-way ANOVA test and Student t-test were used for statistical comparisons. Results: pSMC-CM upregulated MMP-2, TIMP-2, collagen, and elastin gene expression, and MMP-9 activity in human bladder and vaginal cells consistent with elastin metabolism modulation. pSMC-CM treatment restored in vivo urethral function (increase in leak point pressure compared to intact controls, p<0.05) and increased collagen and elastin expression in the urethra and the adjacent vagina. pSMC-CM also restored the smooth muscle cell layer in the adjacent vagina. Conclusion: Conditioned media from smooth muscle cell progenitors derived from pluripotent stem cells restored urethral function and vaginal smooth muscle cell and elastin content. These findings support a novel therapeutic potential for PSC-based treatments for SUI and pelvic floor disorders where tissues are affected by elastin and smooth muscle loss.

show abstract

Strategies of Bladder Reconstruction after Partial or Radical Cystectomy for Bladder Cancer

Zeng,

2024

Mol Biotechnol

View full text Add to dashboard Cite

Smooth Muscle Progenitor Cells Derived From Human Pluripotent Stem Cells Induce Histologic Changes in Injured Urethral Sphincter

Cited by 22 publications

References 49 publications

Efficacy and Safety of Immuno-Magnetically Sorted Smooth Muscle Progenitor Cells Derived from Human-Induced Pluripotent Stem Cells for Restoring Urethral Sphincter Function

Efficacy and Safety of Immuno-Magnetically Sorted Smooth Muscle Progenitor Cells Derived from Human-Induced Pluripotent Stem Cells for Restoring Urethral Sphincter Function

Secretomes of human pluripotent stem cell-derived smooth muscle cell progenitors upregulate extracellular matrix metabolism in the lower urinary tract and vagina

Strategies of Bladder Reconstruction after Partial or Radical Cystectomy for Bladder Cancer

Contact Info

Product

Resources

About