SNP analysis, genotyping and mapping of the porcine <i>PTHR1</i> gene to chromosome 13 (Brief report)

Abstract

Abstract. The parathyroid hormone/parathyroid hormone like hormone type I receptor (PTHR1) belongs to the family of G protein-coupled receptors for peptide hormones, including parathyroid hormone (PTH) and parathyroid hormone like hormone (PTHLH), which participate in epithelial-mesenchymal interactions during the formation and differentiation of epithelial organs (FOLEY et al., 2001; CHOMDEJ et al., 2004). The function of PTHR1 and its ligands suggest its candidacy for traits related to the development of bones and joints but also of mammary gland. The porcine gene was screened for SNPs and assigned to SSC13.

Association of parathyroid hormone‐like hormone (PTHLH) and its receptor (PTHR1) with the number of functional and inverted teats in pigs

“…Two non‐synonymous C>T SNP were detected at nucleotide position 375 (S19L) of the porcine PTHLH cDNA and at nucleotide position 1819 (L556F) of the porcine PTHR1 cDNA (Chomdej et al 2004; Tetzlaff et al 2007). Mendelian inheritance of these polymorphic sites was monitored in individuals of the experimental DUMI population.…”

“…PTHLH was mapped slightly distal of quantitative trait loci (QTL) for number of nipples and the inverted teat defect on SSC5 (Lee et al 2003; Chomdej et al 2004; Rodríguez et al . 2005; Jonas et al 2008), whereas PTHR1 was displayed in close proximity to a QTL for the inverted teat defect on SSC13 (Tetzlaff et al 2007; Jonas et al 2008). The SNP in PTHR1 likely is a marker in close linkage disequilibrium to a causative polymorphism affecting the liability for the inverted teat defect; PTHR1 even represents a good candidate for the causal polymorphism.…”

“…The SNP in PTHR1 likely is a marker in close linkage disequilibrium to a causative polymorphism affecting the liability for the inverted teat defect; PTHR1 even represents a good candidate for the causal polymorphism. The SNP of both genes were found to segregate among pigs of commercial breeds, German Landrace, Large White, Pietrain, Hampshire and Duroc, with allele ‘C’ at both SNP being the prominent one (Chomdej et al 2004; Tetzlaff et al 2007). Effects of both genes on teat phenotypes but also on other traits will be evaluated in animals of commercial dam lines in order to further qualify the genes as functional positional candidate genes in a gene‐assisted selection.…”

“…To amplify the region containing a PTHR1 single nucleotide polymorphism (SNP) primers PTHR‐F: 5′‐GCTATGGTCCGATGGTGTCT‐3′ and PTHR‐R: 5′‐ACTGTCTCCCACTCCTCCTG‐3′ were used and PCR fragments were subsequently incubated with the restriction enzyme Mbo II (Fermentas, St. Leon‐Rot, Germany) suitable to discriminate the C and the T alleles at nt 1819 (GenBank accession no. ; Tetzlaff et al 2007). Amplification reactions were conducted in a final volume of 15 μl, containing 0.5 unit of Taq DNA polymerase, 0.2 m m of each dNTP, 0.2 μ m of each primer, 1x buffer according to the manufacturer’s instruction (GeneCraft, Cologne, Germany) and 50 ng of DNA.…”