SNX20AR/MiRNA-301a-3p/SNX20 Axis Associated With Cell Proliferation and Immune Infiltration in Lung Adenocarcinoma

Yuan, Yixiao; Jiang, Xiulin; Tang, Lin; Wang, Juan; Liu, Qianqian; Zou, Xiaolan; Duan, Lincan

doi:10.3389/fmolb.2021.744363

Cited by 8 publications

(8 citation statements)

References 41 publications

(53 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our previous work showed that SNX20 was down-regulated in NSCLC, overexpression of SNX20 inhibited cell growth and migration abilities of NSCLC cells [ 14 ]. However, no studies have reported the functions of SNX20 in LGG.…”

Section: Discussionmentioning

confidence: 99%

DNA methylation-regulated SNX20 overexpression correlates with poor prognosis, immune cell infiltration, and low-grade glioma progression

Chen

Jiang

Wang

et al. 2022

Aging

Self Cite

View full text Add to dashboard Cite

We revealed that SNX20 was up-regulated in LGG, and its higher expression was associated with adverse clinical outcomes and poor clinical characteristics, including WHO grade, IDH mutation, 1p/19q codeletion, and primary therapy outcome. The results of the Cox regression analysis revealed that SNX20 was an independent factor for the prognosis of low-grade glioma. Meanwhile, we also established a nomogram based on SNX20 to predict the 1-, 3-, or 5-year survival in LGG patients. Furthermore, we found that DNA hypomethylation results in its overexpression in LGG. In addition, functional annotation confirmed that SNX20 was mainly involved in the immune response and inflammatory response related signaling pathways, including the T cell receptor signaling pathway, natural killer cell-mediated cytotoxicity, and the NF-kappa B signaling pathway. Finally, we determined that increased expression of SNX20 was correlated with infiltration levels of various immune cells and immune checkpoint in LGG. Importantly, we found that SNX20 was highly expressed in glioma cell lines. Depletion of SNX20 significantly inhibits glioma cell proliferation and migration abilities. This is the first study to identify SNX20 as a new potential prognostic biomarker and characterize the functional roles of SNX20 in the progression of LGG, and provides a novel potential diagnostic and therapeutic biomarker for LGG in the future.

show abstract

Section: Discussionmentioning

confidence: 99%

DNA methylation-regulated SNX20 overexpression correlates with poor prognosis, immune cell infiltration, and low-grade glioma progression

Chen

Jiang

Wang

et al. 2022

Aging

Self Cite

View full text Add to dashboard Cite

show abstract

“…41,42 The pairing between miRNA and target mRNA may not be specific, thereby allowing miRNAs to regulate a wide range of mRNA targets. 43 miRNA is involved in all cell activity regulation, including cell proliferation, 44,45 differentiation, 46 apoptosis, 47 and pyroptosis. 48 lncRNAs are also transcribed by RNA polymerase II and play a key role in gene activation and silencing, alternative splicing, and posttranslational modification in organisms.…”

Section: Ncrnasmentioning

confidence: 99%

“…The pairing between miRNA and target mRNA may not be specific, thereby allowing miRNAs to regulate a wide range of mRNA targets 43 . miRNA is involved in all cell activity regulation, including cell proliferation, 44,45 differentiation, 46 apoptosis, 47 and pyroptosis 48 …”

Section: The Role Of Ncrnas In Diabetes and Vcdmentioning

confidence: 99%

The role of ncRNAs‐mediated pyroptosis in diabetes and its vascular complications

Feng,

Yang,

Zhong

et al. 2024

Cell Biochemistry & Function

View full text Add to dashboard Cite

Over the past decade, the prevalence of diabetes has increased significantly worldwide, leading to an increase in vascular complications of diabetes (VCD), such as diabetic cardiomyopathy (DCM), diabetic nephropathy (DN), and diabetic retinopathy (DR). Noncoding RNAs (ncRNAs), such as microRNAs (miRNAs), long Noncoding RNAs (lncRNAs), and circular RNAs (circRNAs), play a key role in cellular processes, including the pathophysiology of diabetes and VCD via pyroptosis. ncRNAs (e.g., miR‐17, lnc‐MEG3, and lnc‐KCNQ1OT1) can regulate pyroptosis in pancreatic β cells. Some ncRNAs are involved in VCD progression. For example, miR‐21, lnc‐KCNQ1OT1, lnc‐GAS5, and lnc‐MALAT1 were reported in DN and DCM, and lnc‐MIAT was identified in DCM and DR. Herein, this review aimed to summarize recent research findings related to ncRNAs‐mediated pyroptosis at the onset and progression of diabetes and VCD.

show abstract

“…Human SASH3 full-length cDNA was synthesized (Shanghai Generay Biotech) and sub-cloned into pCDH-CMV-E2F-eGFP lenti-viral vector. Lenti-viruses were generated according to the manufacturer's protocol as previously documented (23), and indicated cells were infected by viruses twice with 48 h and 72 h viral supernatants containing 4 mg/ml polybrene, and stable cell lines were established by appropriate puromycin selection.…”

Section: Constructs Lenti-viral Preparation and Establishment Of Diff...mentioning

confidence: 99%

“…The qRT-PCR assay was performed as documented (23). The primer sequences are listed as follows: SASH3-F: GTGATTTCCCGAACCATGAACA, SASH3-R:…”

Section: Quantitative Real-time Pcrmentioning

confidence: 99%

Pan-Cancer Integrated Analysis Identification of SASH3, a Potential Biomarker That Inhibits Lung Adenocarcinoma Progression

et al. 2022

Self Cite

View full text Add to dashboard Cite

Sterile alpha motif (SAM) and Src homology-3 (SH3) domain-containing 3 (SASH3) is an adaptor protein expressed mainly in lymphocytes, and plays significant roles in T-cell proliferation and cell survival. However, its expression level, clinical significance, and correlation with tumor-infiltrating immune cells across cancers remain unclear. In this study, we comprehensively examined the expression, dysregulation, and prognostic significance of SASH3, and the correlation with clinicopathological parameters and immune infiltration in pan-cancer. The mRNA and protein expression status of SASH3 were determined by TCGA, GTEx, and UALCAN. Kaplan–Meier analysis utilized the prognostic values of SASH3 in diverse cancers. The association between SASH3 expression and gene mutation, DNA methylation, immune cells infiltration, immune checkpoints, tumor mutation burden (TMB), and microsatellite instability (MSI) were analyzed using data from the TCGA database. High expression of SASH3 was not only linked to poor OS in ESCC, LAML, LGG, and UVM, but also associated with better OS in CESC, HNSC, LUAD, SARC, SKCM, THYM, and UCEC. As for DSS, a high level of SASH3 correlated with adverse DSS in ESCC, LGG, and UVM, and lowly expressed SASH3 was associated with shorter OS in CESC, HNSC, LUAD, SARC, SKCM, and UCEC. The results of Cox regression and nomogram analyses confirmed that SASH3 was an independent factor for LUAD prognosis. Gene Ontology (GO), the Kyoto Encyclopedia of Genes and Genomes (KEGG), and gene set enrichment analysis (GSEA) results showed that SASH3 was involved in natural killer cell-mediated cytotoxicity, Th17 cell differentiation, PD-L1 expression and PD-1 checkpoint pathway in cancer, NF-kappa B signaling pathway, B-cell receptor signaling pathway, and Toll-like receptor signaling pathway. SASH3 expression was correlated with TMB in 28 cancer types and associated with MSI in 22 cancer types, while there was a negative correlation between SASH3 expression and DNA methylation in diverse human cancer. The high DNA methylation level of SASH3 was correlated with better OS in KIRC and UVM, and associated with poor OS in SKCM. Moreover, we uncover that SASH3 expression was positively associated with the stroma score in 27 cancer types, the microenvironment score, and immune score in 32 cancer types, 38 types of immune cells in 32 cancer types, the 45 immune stimulators, 24 immune inhibitors, 41 chemokines, 18 receptors, and 21 major histocompatibility complex (MHC) molecules in 33 cancer types. Finally, forced SASH3 expression inhibited lung adenocarcinoma (LUAD) cell proliferation and cell migration. Our findings confirmed that SASH3 may be a biomarker for the prognosis and diagnosis of human cancer.

show abstract

SNX20AR/MiRNA-301a-3p/SNX20 Axis Associated With Cell Proliferation and Immune Infiltration in Lung Adenocarcinoma

Cited by 8 publications

References 41 publications

DNA methylation-regulated SNX20 overexpression correlates with poor prognosis, immune cell infiltration, and low-grade glioma progression

DNA methylation-regulated SNX20 overexpression correlates with poor prognosis, immune cell infiltration, and low-grade glioma progression

The role of ncRNAs‐mediated pyroptosis in diabetes and its vascular complications

Pan-Cancer Integrated Analysis Identification of SASH3, a Potential Biomarker That Inhibits Lung Adenocarcinoma Progression

Contact Info

Product

Resources

About