Sodium Alginate-Based MgO Nanoparticles Coupled Antibiotics as Safe and Effective Antimicrobial Candidates against Staphylococcus aureus of Houbara Bustard Birds

Murtaza, Maheen; Aqib, Amjad Islam; Khan, Shanza Rauf; Muneer, Afshan; Ali, Muhammad Mudassir; Waseem, Ahmad; Zaheer, Tean; Al-Keridis, Lamya Ahmed; Alshammari, Nawaf

doi:10.3390/biomedicines11071959

Cited by 4 publications

(3 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Studies such as Murtaza et al ( 2023) [50] and Liao et al ( 2023) [51] show that MgO has better efficiency when combined with other compounds and still has a wide range of applications, such as an alternative therapeutic approach or for the treatment of plants with bacterial infections. In the work of Nguyen et al (2018) [52] on the study of the activity of the MgO compost, the inhibition activity was 1.0 mg/mL for Escherichia coli, 0.7 mg/mL for Staphylococcus aureus, and 1.2 mg/mL for Candida albicans.…”

Section: Discussionmentioning

confidence: 99%

Synthesis of Green Brucite [NixMg1−x(OH)2] by Incorporation of Nickel Ions in the Periclase Phase (MgO) Applied as Pigments

Siqueira,

Schons,

Appelt

et al. 2024

Colorants

View full text Add to dashboard Cite

Magnesium oxide is typically white and can be colorized with transition metal insertion by doping. We present the preparation of a green-colored hydroxide by the exchange of Mg2+ on the crystalline lattice with Ni2+ in MgO, using three nickel salts. MgOst was prepared by the colloidal starch suspension method, using cassava starch. The oxides and hydroxides, before and after, were characterized by X-ray diffraction (XRD), and show that a phase change occurs: a transition from periclase (MgO) to brucite (Mg(OH)2) due to the incorporation of nickel ions from different salts (acetate, chloride, and nitrate), resulting in the solid solution [NixMg1−x(OH)2]. The FTIR spectrum corroborates the crystallographic structure identified through XRD patterns, confirming the formation of a crystal structure resembling brucite. The new samples present a green color, indicative of the incorporation of the Ni2+ ions. The antimicrobial activity of products resulting from the doping of magnesium oxide with nickel and the precursor MgOst was assessed through the minimum inhibitory concentration (MIC) test. The evaluation included three bacterial strains: Staphylococcus aureus (ATCC 25923), Escherichia coli (ATCC 25922), Salmonella gallinarum (ATCC 9184), and a yeast strain, Candida albicans (ATCC 10231). The obtained results were promising; the tested samples exhibited antimicrobial activity, with a MIC ranging from 0.312 to 0.625 μg.μL−1. The nickel compound, derived from the precursor chloride salt, demonstrated superior MIC activity. Notably, all tested samples displayed bactericidal activity against the S. aureus strain and exhibited a broad spectrum of inhibition, encompassing both Gram-positive and Gram-negative strains. Only the nickel compounds derived from precursors with acetate and nitrate anions demonstrated antimicrobial activity against C. albicans, exhibiting a fungistatic behavior. Based on the conducted studies, [NixMg1−x(OH)2] has emerged as a promising antimicrobial agent, suitable for applications requiring the delay or inhibition of bacterial growth.

show abstract

Section: Discussionmentioning

confidence: 99%

Synthesis of Green Brucite [NixMg1−x(OH)2] by Incorporation of Nickel Ions in the Periclase Phase (MgO) Applied as Pigments

Siqueira,

Schons,

Appelt

et al. 2024

Colorants

View full text Add to dashboard Cite

show abstract

“…Studies such as Murtaza et al (2023) [39] and Liao et al (2023) [34] show that MgO has better efficiency when combined with other compounds and still has a wide range of applications, such as an alternative therapeutic approach or for the treatment of plants with bacterial infections. In the work of Nguyen et al (2018) [41] on the study of the activity of the MgO compost, the inhibition activity was 1.0 mg.mL-1 for E. coli, 0.7 mg.mL-1 for S. aureus and 1.2 mg.mL-1 for C. albicans, respectively.…”

Section: Discussionmentioning

confidence: 99%

Preparation of green brucite [NixMg1-x(OH2)] resulting from the combination of nickel ions and periclase (MgO) applied against yeast and bacteria

Siqueira,

Schons,

Appelt

et al. 2023

Preprint

View full text Add to dashboard Cite

Magnesium oxide is typically white and can be colorized with transition metal insertion by doping or by adsorption. We present the preparation of green colored hydroxide by the adsorption of nickel ions by porous MgO. MgO was prepared by the colloidal starch suspension method and used to remove nickel ions from the aqueous solution. The oxides and hydroxides, before and after adsorption, were characterized by X-ray diffraction technical, and show that a phase change occurs, a transition from periclase (MgO) to brucite (Mg(OH)2) due to the interaction with nickel salts (acetate, chloride, and nitrate). The FTIR spectrum corroborates with the DRX data on the formation of brucite like crystal lattices. The new samples present a green color, indicative of the incor-po-ration of the Ni2+ ions. Mixed oxides in the form of brucite were used in microbiological tests and showed action against fungi and bacteria, with bactericidal, bacteriostatic, or fungistatic function. Green brucite (NixMg1-x(OH)2) can be used as an inorganic pigment in white or colorless paints with a special biocidal property.

show abstract

“…Biochemical confirmation of the isolates was performed as per the guidelines of Bergey's' Manual of Determinative Bacteriology [7]. Further, the isolates were also confirmed via molecular analysis by targeting nuc genes (500 bp with primers as "forward primers 5 AAGGGCAATACGCAAAGAG 3 and reverse primers 5 AAACATAAGCAACTTTAGCCAAG 3 ") in S. aureus (Figure S1) [14] and 23S rRNA gene (at 231 bp using primers E23S-F: ATCAACCGATTCCCCAGT; E23S-R: TCACTATCGGTCAGTCAGGAG) for E. coli (Figure S2) [15].…”

Section: Isolation and Antibiotic Susceptibility Profile Of Mastitis ...mentioning

confidence: 99%

Validating Interactions of Pathogenic Proteins of Staphylococcus aureus and E. coli with Phytochemicals of Ziziphus jujube and Acacia nilotica

Zou,

Hassan,

Akram

et al. 2023

Microorganisms

Self Cite

View full text Add to dashboard Cite

This study focused on the assessment of the antimicrobial resistance of Staphylococcus aureus (S. aureus) and Escherichia coli (E. coli) isolated from bovine mastitis milk samples and the revealing anti-mastitis potential of phytocompounds of Ziziphus jujube and Acacia nilotica through molecular docking analysis. The mastitis milk samples were collected from various dairy farms for the isolation of the bacteria (S. aureus and E. coli) and their response to antibiotics. Ethanolic extracts of both plants were prepared. Their antibacterial activity was evaluated, and they were processed for phytochemical analysis after which, molecular docking analysis with pathogenic proteins of the bacteria was carried out. Parametric and non-parametric statistical analyses were performed to reach the conclusions of this study. The findings of the study revealed a higher drug resistance (≥40%) of E. coli against ampicillin, amikacin, and vancomycin, while S. aureus exhibited the highest resistance to ampicillin, erythromycin, and ciprofloxacin. The ethanolic extracts of the Ziziphus jujube and Acacia nilotica plants produced a ZOI between 18 and 23 mm against multidrug-resistant S. aureus and E. coli. Gas chromatography–mass spectrophotometry (GC–MS) was used to explore 15 phytocompounds from Ziziphus jujube and 18 phytocompounds from Acacia nilotica. The molecular docking analysis of 2cyclopenten−1-one,3,4,4 trimethyl and Bis (2ethylhexyl) phthalate of Ziziphus jujube showed a binding affinity of −4.8 kcal/mol and −5.3 kcal/mol and −5.9 kcal/mol and −7.1 kcal/mol against the DNA Gyrase and toxic shock syndrome toxin-1 proteins of S. aureus and E. coli, respectively. The suberic acid monomethyl ester of Acacia nilotica showed a binding affinity of −5.9 kcal/mol and −5 kcal/mol against the outer membrane protein A and Topoisomerase IV protein of E. coli and −5.1 kcal/mol and −5.8 kcal/mol against the toxic shock syndrome toxin-1 and Enterotoxin B proteins of S. aureus. Similarly, 2,2,4-trimethyl-1,3-pentanediol di-iso-butyrate showed a binding affinity of −6.5 kcal/mol and −5.3 kcal/mol against the outer membrane protein A and Topoisomerase IV of E. coli and −5.2 kcal/mol and −5.9 kcal/mol against the toxic shock syndrome toxin-1 and Enterotoxin B proteins of S. aureus, respectively. The study concluded that there was an increasing trend for the antimicrobial resistance of S. aureus and E. coli, while the Ziziphus jujube and Acacia nilotica plant extracts expressed significant affinity to tackle this resistance; hence, this calls for the development of novel evidence-based therapeutics.

show abstract

Sodium Alginate-Based MgO Nanoparticles Coupled Antibiotics as Safe and Effective Antimicrobial Candidates against Staphylococcus aureus of Houbara Bustard Birds

Cited by 4 publications

References 30 publications

Synthesis of Green Brucite [NixMg1−x(OH)2] by Incorporation of Nickel Ions in the Periclase Phase (MgO) Applied as Pigments

Synthesis of Green Brucite [NixMg1−x(OH)2] by Incorporation of Nickel Ions in the Periclase Phase (MgO) Applied as Pigments

Preparation of green brucite [NixMg1-x(OH2)] resulting from the combination of nickel ions and periclase (MgO) applied against yeast and bacteria

Validating Interactions of Pathogenic Proteins of Staphylococcus aureus and E. coli with Phytochemicals of Ziziphus jujube and Acacia nilotica

Contact Info

Product

Resources

About