Sodium chloride regulation of the α epithelial amiloride-sensitive sodium channel (αENaC) gene requires syntheses of new protein(s)

Lim, Wonchung; Kim, Dukkyung; Park, Jeong Bae; Kim, Suhn Hee; Lee, Young‐Joo

doi:10.1016/j.jsbmb.2003.12.008

Cited by 5 publications

(4 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The signal from each sample was normalized on the basis of its GAPDH content. RT-PCR in A7r5 cells was performed as previously described [14]. The following primers were used: for the mineralocorticoid receptor (MR), 5 0 -CTTC AAAAGAGCCGTGGAAGGG-3 0 (sense) and 5 0 -CGAC CTGGATCATCTGTTTCGCTGC-3 0 (antisense); for rTRPC6, 5 0 -CACCGGCGGCAGACAGTTCTTCG-3 0 (sense) and 5 0 CTTGCTGGAGTTCAGACTGGCTG G-3 0 (antisense); and, for the ribosomal protein L19 (used as a loading control), 5 0 -CTGAAGGTCAAAGGGAAT GTG-3 0 (sense) and 5 0 -GGACAGAGTCTTGATGATC TC-3 0 (antisense).…”

Section: Cell Preparation and Electrophysiological Recordingsmentioning

confidence: 99%

“…Western blot analysis SDS-PAGE (on 7.5% separating gels) and immunoblotting were carried out with samples from A7r5 cells according to standard protocols [14]. Polyvinylidene difluoride membranes were blocked in 5% nonfat dry milk in Tris-buffered saline containing 0.1% Tween-20 for 60 min at room temperature.…”

Section: Cell Preparation and Electrophysiological Recordingsmentioning

confidence: 99%

See 1 more Smart Citation

Enhancement of receptor-operated cation current and TRPC6 expression in arterial smooth muscle cells of deoxycorticosterone acetate-salt hypertensive rats

Bae¹,

Kim

Lee

et al. 2007

Journal of Hypertension

Self Cite

View full text Add to dashboard Cite

show abstract

Section: Cell Preparation and Electrophysiological Recordingsmentioning

confidence: 99%

Section: Cell Preparation and Electrophysiological Recordingsmentioning

confidence: 99%

Enhancement of receptor-operated cation current and TRPC6 expression in arterial smooth muscle cells of deoxycorticosterone acetate-salt hypertensive rats

Bae¹,

Kim

Lee

et al. 2007

Journal of Hypertension

Self Cite

View full text Add to dashboard Cite

show abstract

“…A high sodium diet and intraperitoneal injection of hypertonic saline decreases the expression of ENaC mRNA and protein in the kidney (Loffing et al 2000;Lim et al 2004). Aldosterone, which is the main hormone in sodium homeostasis, regulates ENaC expression, activity, and trafficking to the cell surface in mammalian kidney (Loffing et al 2001b;Verrey et al 2003).…”

Section: Discussionmentioning

confidence: 99%

Immunolocalization and mRNA expression of the epithelial Na+ channel α-subunit in the kidney and urinary bladder of the marine toad, Bufo marinus, under hyperosmotic conditions

et al. 2007

View full text Add to dashboard Cite

The amiloride-sensitive epithelial sodium channel (ENaC) has previously been shown to be involved in the maintenance of body fluid volume and in Na(+) absorption across the skin and urinary bladder in amphibians. However, the function and distribution of ENaC have not been clearly described in amphibian kidney. We therefore cloned the ENaC alpha-subunit cDNA from kidney of the marine toad, Bufo marinus. The ENaC mRNA and protein were abundantly expressed in the kidney and in the urinary bladder and ventral pelvic skin. In an immunohistochemical study, the ENaC alpha-subunit protein was specifically localized to the apical membrane of the principal cells but not the intercalated cells from the late distal tubule to the collecting duct in the kidney or in the apical area of cells of urinary bladder epithelia. When toads were acclimated to dry and hyper-saline environments, the levels of ENaC mRNA expression in the kidney and urinary bladder decreased under hyper-saline acclimation, but not under dry conditions. Immunohistochemical observations indicated that the levels of ENaC protein expression were much lower in the apical area of renal distal tubules and urinary bladder epithelia of hyper-saline acclimated toad compared with controls. The present study suggests that Bufo ENaC is significantly expressed and functions during Na(+) reabsorption in the apical membrane domain in the distal nephron of normal and desiccated toads. Natriuresis may be caused by decreases in ENaC expression and its trafficking to the cell surface in the distal nephron, a response to prevent excessive Na(+) reabsorption in hyper-saline-acclimated toads.

show abstract

“…In experimental animals, saline administration has been shown to downregulate alphaENaC mRNA levels, which could be blocked by administration of an inhibitor of protein synthesis, cycloheximide [33]. Moreover, ENaC has been shown to be involved in the flavonoid-induced blood pressure reduction in the Dahl salt-sensitive rat model, presumably by downregulation of ENaC expression in the kidney [34].…”

Section: Enacmentioning

confidence: 99%

Pathogenesis of salt sensitivity of blood pressure

Weinberger

2006

Current Science Inc

View full text Add to dashboard Cite

The effect of sodium in human blood pressure has been a contentious subject of considerable debate for decades. Nonetheless, it is generally conceded that there is heterogeneity to alterations in sodium and extracellular fluid volume in the blood pressure responses of normal and hypertensive humans. Although there are many forms of experimental and clinical hypertension that are clearly related to abnormalities of sodium handling and metabolism, it has been only the advent of the genetic revolution that has provided critical new insight into the mechanisms involved in many of these conditions. In this review, the clinical manifestations of salt sensitivity and several clinical syndromes associated with abnormal sodium metabolism are discussed, and factors that appear to be involved in many of the clinical abnormalities as well as relevant new insights derived from basic research are elucidated.

show abstract

Sodium chloride regulation of the α epithelial amiloride-sensitive sodium channel (αENaC) gene requires syntheses of new protein(s)

Cited by 5 publications

References 34 publications

Enhancement of receptor-operated cation current and TRPC6 expression in arterial smooth muscle cells of deoxycorticosterone acetate-salt hypertensive rats

Enhancement of receptor-operated cation current and TRPC6 expression in arterial smooth muscle cells of deoxycorticosterone acetate-salt hypertensive rats

Immunolocalization and mRNA expression of the epithelial Na+ channel α-subunit in the kidney and urinary bladder of the marine toad, Bufo marinus, under hyperosmotic conditions

Pathogenesis of salt sensitivity of blood pressure

Contact Info

Product

Resources

About