Soil microbes and associated extracellular enzymes largely impact nutrient bioavailability in acidic and nutrient poor grassland ecosystem soils

Ndabankulu, Khululwa; Egbewale, Samson O.; Tsvuura, Zivanai; Magadlela, Anathi

doi:10.1038/s41598-022-16949-y

Cited by 26 publications

(13 citation statements)

References 57 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The enzymes not just promote plant growth and development but also has a direct impact on the plant-microbe symbiosis ( Eid et al., 2019 ). For example, the insoluble cation-bound phosphate complexes are solubilized by phosphatases, making them accessible for plant uptake ( Ndabankulu et al., 2022 ). We assessed the activities of extracellular enzymes, i.e., Phos, NAG, CL, AG, and BG.…”

Section: Discussionmentioning

confidence: 99%

The silicon regulates microbiome diversity and plant defenses during cold stress in Glycine max L.

Ahmad,

Coffman,

Weerasooriya

et al. 2024

Front. Plant Sci.

View full text Add to dashboard Cite

IntroductionWith climate change, frequent exposure of bioenergy and food crops, specifically soybean (Glycine max L.), to low-temperature episodes is a major obstacle in maintaining sustainable plant growth at early growth stages. Silicon (Si) is a quasi-essential nutrient that can help to improve stress tolerance; however, how Si and a combination of cold stress episodes influence plant growth, plant physiology, and microbiome diversity has yet to be fully discovered.MethodsThe soybean plants were exposed to cold stress (8-10°C) with or without applying Si, and the different plant organs (shoot and root) and rhizospheric soil were subjected to microbiome analysis. The plant growth, physiology, and gene expression analysis of plant defenses during stress and Si were investigated.Results and discussionWe showed that cold stress significantly retarded soybean plants’ growth and biomass, whereas, Si-treated plants showed ameliorated negative impacts on plant growth at early seedling stages. The beneficial effects of Si were also evident from significantly reduced antioxidant activities – suggesting lower cold-induced oxidative stress. Interestingly, Si also downregulated critical genes of the abscisic acid pathway and osmotic regulation (9-cis-epoxy carotenoid dioxygenase and dehydration-responsive element binding protein) during cold stress. Si positively influenced alpha and beta diversities of bacterial and fungal microbiomes with or without cold stress. Results showed significant variation in microbiome composition in the rhizosphere (root and soil) and phyllosphere (shoot) in Si-treated plants with or without cold stress exposures. Among microbiome phyla, Proteobacteria, Bacteroidota, and Ascomycota were significantly more abundant in Si treatments in cold stress than in control conditions. For the core microbiome, we identified 179 taxa, including 88 unique bacterial genera in which Edaphobacter, Haliangium, and Streptomyces were highly abundant. Enhanced extracellular enzyme activities in the cold and Si+cold treatments, specifically phosphatase and glucosidases, also reflected the microbiome abundance. In conclusion, this work elucidates cold-mediated changes in microbiome diversity and plant growth, including the positive impact Si can have on cold tolerance at early soybean growth stages – a step toward understanding crop productivity and stress tolerance.

show abstract

Section: Discussionmentioning

confidence: 99%

The silicon regulates microbiome diversity and plant defenses during cold stress in Glycine max L.

Ahmad,

Coffman,

Weerasooriya

et al. 2024

Front. Plant Sci.

View full text Add to dashboard Cite

show abstract

“…Pure bacterial colonies were obtained by repeated streaking/ subculturing. A small portion of the pure bacterial colonies was amplified through polymerase chain reaction (PCR) using the 16S ribosomal RNA gene primers: 63F (5 ′ CAGGCCTAACACATGCAAGTC 3 ′ (21 bases) and 1387R (5 ′ GGGCGGTGTGTACAAGGC 3 ′ (18 bases)) [32] from Inqaba Biotechnical Industries (Pty) Ltd. (South Africa). The PCR amplification was performed using an EmaraldAmp GT Master Mix with the following conditions: Initial denaturation at 94 • C for 5 min, followed by 30 cycles of denaturation at 94 • C for 30 s, annealing at 55 • C for 30 s and extension at 72 • C for 2 min, with additional extension at 72 • C for 10 min.…”

Section: Bacterial Extraction and Identification From Coralloid Roots...mentioning

confidence: 99%

Exploring the Influence of Ecological Niches and Hologenome Dynamics on the Growth of Encephalartos villosus in Scarp Forests

Motsomane,

Suinyuy,

Pérez-Fernández

et al. 2024

Soil Systems

Self Cite

View full text Add to dashboard Cite

Information on how bacteria in plants and soil, along with extracellular enzymes, affect nutrient cycling in Encephalartos villosus growing in phosphorus deficient and acidic scarp forests is lacking. Bacteria in coralloid roots, rhizosphere, and non-rhizosphere soils were isolated to determine the potential role of soil bacterial communities and their associated enzyme activities in nutrient contributions in rhizosphere and non-rhizosphere soils. The role of soil characteristics and associated bacteria on E. villosus nutrition and nitrogen source reliance was investigated. Encephalartos villosus leaves, coralloid roots, rhizosphere, and non-rhizosphere soils were collected at two scarp forests. Leaf nutrition, nitrogen source reliance, soil nutrition, and extracellular enzyme activities were assayed. A phylogenetic approach was used to determine the evolutionary relationship between identified bacterial nucleotide sequences. The clustering pattern of isolated bacterial strains was primarily dictated by the ecological niches from which they originated (rhizosphere soil, non-rhizosphere soil, and coralloid roots), thus indicating that host-microbe interactions may be a key driver of this pattern, in line with the hologenome theory. There were insignificant differences in the phosphorus and nitrogen cycling enzyme activities in E. villosus rhizosphere and non-rhizosphere soils in both localities. Significantly positive correlations were recorded between nitrogen and phosphorus cycling enzymes and phosphorus and nitrogen concentrations in rhizosphere and non-rhizosphere soils. Additionally, more than 70% of the leaf nitrogen was derived from the atmosphere. This study challenged the conventional expectation that environmental filters alone dictate microbial community composition in similar habitats and revealed that host-microbe interactions, as proposed by the hologenome theory, are significant drivers of microbial community structuring. The isolated bacteria and their plant growth promoting traits play a role in E. villosus nutrition and nitrogen source reliance and secrete nutrient cycling enzymes that promote nutrient availability in rhizosphere and non-rhizosphere soils.

show abstract

“…Soil organic matter is largely processed by microorganisms and dependent on concentration, composition and a variety of biotic and abiotic factors [ 3 , 35 , 37 , 40 , 41 , 59 ]. Most research has been performed to understand microbial organic matter decomposition in soils during standard conditions (temperature and high-water-content conditions) [ 3 , 35 , 37 , 40 , 41 , 59 ] and after wetting events [ 72 , 73 , 74 , 75 , 76 ], but scarce information is available on the potential of microbial activity under extreme events (i.e., high temperature, desiccation) [ 15 , 19 , 43 , 77 ]. Soil thermophiles are able to thrive under periodic or sporadic hot and dry periods (and survive in the cold), unlike what is assumed for most microorganisms.…”

Section: Organic Matter Decompositionmentioning

confidence: 99%

“…Extracellular enzyme activity has been proposed as an indicator of soil microbial activity [ 39 , 40 , 41 ], and it is commonly measured in ecological studies [ 37 , 40 , 41 , 42 , 43 , 44 ]. Soil thermophiles have been reported as a major source for extracellular enzymes dominating the pool of enzymes in soils [ 19 ] because they present higher total activity than the corresponding enzymes from mesophiles ( Figure 1 ) [ 18 , 19 , 45 ].…”

Section: Introductionmentioning

confidence: 99%

Soil Thermophiles and Their Extracellular Enzymes: A Set of Capabilities Able to Provide Significant Services and Risks

et al. 2023

View full text Add to dashboard Cite

During this century, a number of reports have described the potential roles of thermophiles in the upper soil layers during high-temperature periods. This study evaluates the capabilities of these microorganisms and proposes some potential consequences and risks associated with the activity of soil thermophiles. They are active in organic matter mineralization, releasing inorganic nutrients (C, S, N, P) that otherwise remain trapped in the organic complexity of soil. To process complex organic compounds in soils, these thermophiles require extracellular enzymes to break down large polymers into simple compounds, which can be incorporated into the cells and processed. Soil thermophiles are able to adapt their extracellular enzyme activities to environmental conditions. These enzymes can present optimum activity under high temperatures and reduced water content. Consequently, these microorganisms have been shown to actively process and decompose substances (including pollutants) under extreme conditions (i.e., desiccation and heat) in soils. While nutrient cycling is a highly beneficial process to maintain soil service quality, progressive warming can lead to excessive activity of soil thermophiles and their extracellular enzymes. If this activity is too high, it may lead to reduction in soil organic matter, nutrient impoverishment and to an increased risk of aridity. This is a clear example of a potential effect of future predicted climate warming directly caused by soil microorganisms with major consequences for our understanding of ecosystem functioning, soil health and the risk of soil aridity.

show abstract

Soil microbes and associated extracellular enzymes largely impact nutrient bioavailability in acidic and nutrient poor grassland ecosystem soils

Cited by 26 publications

References 57 publications

The silicon regulates microbiome diversity and plant defenses during cold stress in Glycine max L.

The silicon regulates microbiome diversity and plant defenses during cold stress in Glycine max L.

Exploring the Influence of Ecological Niches and Hologenome Dynamics on the Growth of Encephalartos villosus in Scarp Forests

Soil Thermophiles and Their Extracellular Enzymes: A Set of Capabilities Able to Provide Significant Services and Risks

Contact Info

Product

Resources

About