Solid-Phase Synthesis of Positively Charged Deoxynucleic Guanidine (DNG) Tethering a Hoechst 33258 Analogue:  Triplex and Duplex Stabilization by Simultaneous Minor Groove Binding

Abstract

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.

Biophysical and Cellular‐Uptake Properties of Mixed‐Sequence Pyrrolidine–Amide Oligonucleotide Mimics

“…[30] Effects of change in ionic strength on POM binding to DNA/RNA: It would be expected that if electrostatic attraction played a major part in the binding of POM to DNA and RNA, melting temperatures would decrease with increasing ionic strength, as is the case for the binding of the cationic DNG to DNA and RNA. [31,32] Increasing the salt concentration from 0.12 to 0.62 m resulted in a slight decrease in T m (heating) for Gly-POM-TACTCATACTCT-NH 2 (2) binding to complementary DNA (Table 1), with no change in the hyperchromicity. Hysteresis increased slightly with increasing ionic strength, and a melting temperature could not be determined from the renaturation curve between POM and DNA at higher salt concentrations; this indicates that ionic strength can have some effect on the rate of association and dissociation ( Figure S12 in the Supporting Information).…”

(Pseudo)amide-linked oligosaccharide mimetics: molecular recognition and supramolecular properties

“…A pentameric thymidyl DNG incorporating bis-benzimidazole (Hoechst 33258) ligand ( 64 ) was synthesised [105]. The stability of DNG-Hoechst conjugates 64 and 65 with a 30-mer double-strand DNA (dsDNA) and single-strand DNA (ssDNA) were evaluated.…”

Synthesis and affinity to DNA of phenylbenzoimidazoles and benzoimidazo[1,2-c]quinazolines

“…It is reported in most cases that crescent-shaped molecules containing one or several benzoimidazole motifs (Hoechst 33258, etc.) are well-known minor groove binding agents [28][29][30][31][32][33][34][35][36]. But then it was shown by Denny et al [37], the short ''round'' substituted phenylbenzoimidazole derivatives 2 (R ¼ CH 3 , Cl, Ph) are also capable of intercalating into DNA (lg K a ¼ 5.04-6.43) as it demonstrated in ethidium bromide displacement assay studies.…”