Solution Structure of a Designed Spirocyclic Helical Ligand Binding at a Two-Base Bulge Site in DNA

Abstract

The solution structure of the complex formed between an oligodeoxynucleotide containing a twobase bulge (5′-CCATCGTCTACCTTTGGTAGGATGG) and SCA-α2, a designed spirocyclic helical molecule, has been elucidated. SCA-α2, a close mimic of the metabolite, NCSi-gb, of the DNA bulge-specific enediyne antibiotic neocarzinostatin, differs in possessing a more stable spirocyclic ring system and in lacking certain bulky groupings that compromise bulged DNA binding. This study provides a detailed comparison of the binding modes of the two complexes and provides new insights into the importance of shape and space, as opposed to simple nucleotide sequence, in complex formation at the bulge site. The two rigidly held aromatic rings of SCA-α2 form a righthanded helical molecular wedge that specifically penetrates the bulge binding pocket and immobilizes the two bulge residues (GT), which point towards the minor groove, rather than the major groove as in the NCSi-gb•bulged DNA complex. The ligand aromatic ring systems stack on the DNA bulge-flanking base pairs that define the long sides of the triangular prism binding pocket. Like NCSi-gb, SCA-α2 possesses the natural N-methyl furanose moiety, α-linked to the benzindanol (BI) moiety. The aminosugar anchors in the major groove of the DNA and points toward the 3′-bulgeflanking base pair. Lacking the bulky cyclocarbonate of NCSi-gb, the SCA-α2•bulged DNA complex has a much less twisted and buckled 3'-bulge-flanking base pair (dG20·dC8), and the G20 residue stacks directly above the BI ring platform. Also, the absence of the methyl group and the free rotation of the methoxy group on the dihydronaphthanone (NA) moiety of SCA-α2 allow better stacking geometry of the NA ring above the 5′-bulge-flanking base pair dG21·dC5. These and other considerations help to explain why NCSi-gb binds very poorly to bulged RNA and are consistent with the recent observation of good binding with SCA-α2. Thus, although the two complexes resemble each other closely, they differ in important local environmental details. SCA-α2 has a better * To whom correspondence should be addressed: Irving H. Goldberg, Telephone: (617) (Table S1), proton chemical shift changes (ppm) of the bound form of SCA-α2 in the SCA-α2•bulged 25-mer DNA complex (in D 2 O at 25 °C) relative to the free form of SCA-α2 (in d4-MeOH at 25 °C) (Table S2), the exchangeable proton chemical shifts (ppm) of DNA components within the SCA-α2•bulged 25-mer DNA complex in H 2 O buffer at pH 6.8 and 10°C (Table S3 A), the non-exchangeable proton chemical shifts (ppm) of DNA components within the SCA-α2•bulged 25-mer DNA complex in D 2 O buffer at pH 6.8 and 10°C (Table S3 B), the titration of various amount of SCA-α2 into 25-mer bulged DNA as monitored by 1 H NMR spectra shown as expanded imino proton region ( Figure S1), the expanded NOESY (200 ms mixing time) contour plots of the SCA-α2•bulged 25mer DNA complex, focusing on the amino and aromatic proton regions ( Figure S2), the expanded NOESY (200 ms mixing time) contour plots for the b...

Structure-Based DNA-Targeting Strategies with Small Molecule Ligands for Drug Discovery

“…Considering that these two NCS derivatives have the similar composition and structure, the striking differences observed from their DNA complexes provided important insight into DNA recognition and specificity, which are valuable for drug design and discovery. Later on, the same research group designed a new spirocyclic helical ligand, which is similar to the NCSi‐gb structure without the bulky cyclocrabonate moiety, and they solved the solution structure of a two‐base bulge‐containing DNA bound with this new ligand . However, the structure revealed that this ligand binds to the minor groove.…”

“…Goldberg and co‐workers solved a solution structure of a designed spirocyclic helical ligand (SCA‐alpha2) (Fig. A) bound at the two‐base bulge site in a DNA duplex [d(5′‐CCATCGTCTACCTTTGGTAGGATGG‐3′) 2 ] . SCA‐alpha2 is a close mimic of the previously discussed NCSi‐gb binder to the major groove.…”

“…As shown in Figure B, the two rigid aromatic rings of the ligand stack on the DNA bulge bases and form a right‐handed helical wedge that can penetrate the bulge‐binding pocket and immobilize the two bulge residues (GT), which point toward the minor groove. The amino sugar anchors in the DNA major groove and points toward the 3′‐bulge‐flanking base pair . These details suggest that both shape and space are important in designing novel ligand targeting the duplex bulge site.…”

Designed DNA probes from the neocarzinostatin family: Impact of glycosyl linkage stereochemistry on bulge base binding

“…12,13 This is further supported by comparison of the ORTEP for the basic spirocyclic structure 11 (Figure 3), 14 where the (offset) arenes seem ideally suited to occupy the floor of the bulged cavity, the appended (glycosyl) elements serving to impart secondary, sequence selectivity.…”

In vitro expansion of DNA triplet repeats with bulge binders and different DNA polymerases

“…Several groups have shown an interest in developing small molecules that possess specific effects for DNA triplet repeat strand slippage [14][15][16][17][18][19][20][21][22][23]. The most promising and successful bulge-specific agent discovered to date originated from studies on the enediyne natural product neocarzinostatin chromophore (NCS-chrom) [24].…”