Sonic Hedgehog Regulates Osteoblast Function by Focal Adhesion Kinase Signaling in the Process of Fracture Healing

Abstract

Several biological studies have indicated that hedgehog signaling plays an important role in osteoblast proliferation and differentiation, and sonic hedgehog (SHH) expression is positively correlated with phosphorylated focal adhesion kinase (FAK) Tyr397. However, the relationship between them and their role in the process of normal fracture repair has not been clarified yet. Immunohistochemical analysis revealed that SHH and pFAK Tyr397 were expressed in bone marrow cells and that pFAK Tyr397 was also detected in ALP-positive osteoblasts near the TRAP-positive osteoclasts in the fracture site in the ribs of mice on day 5 after fracture. SHH and pFAK Tyr397 were detectable in osteoblasts near the hypertrophic chondrocytes on day 14. In vitro analysis showed that SHH up-regulated the expression of FAK mRNA and pFAK Tyr397 time dependently in osteoblastic MC3T3-E1 cells. Functional analysis revealed that 5 lentivirus encoding short hairpin FAK RNAs (shFAK)-infected MC3T3-E1 cell groups displayed a round morphology and decreased proliferation, adhesion, migration, and differentiation. SHH stimulated the proliferation and differentiation of MC3T3-E1 cells, but had no effect on the shFAK-infected cells. SHH also stimulated osteoclast formation in a co-culture system containing MC3T3-E1 and murine CD11b+ bone marrow cells, but did not affect the shFAK-infected MC3T3-E1 co-culture group. These data suggest that SHH signaling was activated in osteoblasts at the dynamic remodeling site of a bone fracture and regulated their proliferation and differentiation, as well as osteoclast formation, via FAK signaling.

Enterococcus faecalis attenuates osteogenesis through activation of p38 and ERK1/2 pathways in MC3T3‐E1 cells

“…), 5′‐TTCTCCAACCCACGAATGCAC‐3′ and 5′‐CAGGTACGTGTGGTAGTGAGT‐3′ forward and reverse primers for Runx2 (Horikiri et al . ), 5′‐AATGGTGCTCCTGGTATTGC‐3′ and 5′‐ GGCACCAGTGTCTCCTTTGT‐3′ forward and reverse primers for COL1 (Alford et al . ).…”

“…Gene expression levels of ALP, OC, Runx2 and COL1 were measured using real-time PCR. Primer sequences were 5 0 -AACCCAGACACAAGCATTCC 3 0 and 5 0 -GCCTTTGAGGTTTTTGGTCA-3 0 forward and reverse primers for ALP (Negishi-Koga et al 2011), 5 0 -CGCTCTGTCTCTCTGACCTC-3 0 and 5 0 -TCACAAG CAGGGTTAAGCTC-3 0 forward and reverse primers for OC (Alford et al 2010), 5 0 -TTCTCCAACCCACGAATG CAC-3 0 and 5 0 -CAGGTACGTGTGGTAGTGAGT-3 0 forward and reverse primers for Runx2 (Horikiri et al 2013), 5 0 -AATGGTGCTCCTGGTATTGC-3 0 and 5 0 -GGCACCAGTGTCTCCTTTGT-3 0 forward and reverse primers for COL1 (Alford et al 2010).…”

Sonic Hedgehog Regulates Bone Fracture Healing

“…The right eighth rib of each experimental animal was fractured as previously described [10]. Briefly, each experimental animal was anesthetized, and the eighth rib on the right side was exposed and cut vertical to the axis with scissors.…”

“…In general, Shh acts in the early stages of development to regulate patterning and growth [9]. Recently, several studies reported that Shh might be related to fracture healing [10,11]. Following the inactivation of HH signaling, the activity of Smo is inhibited by a receptor known as Patched (Ptch).…”

Orthognathic surgery during breast cancer treatment—A case report

“…Mandible bone healing after IVRO could be associated with normal bone development, including not only cartilage and bone formation, but also endochondral resorption and bone remodeling. According to a previous in vitro study, chondrocytes are remodeled and bone remodeling is started 6 weeks after fracture [18], [19]. The effect of the estrogen inhibitor tamoxifen should be further explored in clinical studies.…”