Spatiotemporal patterns of avian host–parasite interactions in the face of biogeographical range expansions

Abstract

Exploration of interactions between hosts and parasitic symbionts is important for our understanding of the temporal and spatial distribution of organisms. For example, host colonization of new geographical regions may alter levels of infections and parasite specificity, and even allow hosts to escape from co‐evolved parasites, consequently shaping spatial distributions and community structure of both host and parasite. Here we investigate the effect of host colonization of new regions and the elevational distribution of host–parasite associations between birds and their vector‐transmitted haemosporidian blood parasites in two geological and geographical settings: mountains of New Guinea and the Canary Islands. Our results demonstrate that bird communities in younger regions have significantly lower levels of parasitism compared to those of older regions. Furthermore, host–parasite network analyses demonstrate that blood parasites may respond differently after arriving to a new region, through adaptations that allow for either expanding (Canary Islands) or retaining (New Guinea) their host niches. The spatial prevalence patterns along elevational gradients differed in the two regions, suggesting that region‐specific biotic (e.g., host community) and abiotic factors (e.g., temperature) govern prevalence patterns. Our findings suggest that the spatiotemporal range dynamics in host–parasite systems are driven by multiple factors, but that host and parasite community compositions and colonization histories are of particular importance.

Avian Haemosporidian Diversity on Sardinia: A First General Assessment for the Insular Mediterranean

“…We found substantial differences in infection rate across bird families (Table 1) suggesting that certain families experience a higher amount of parasite infections than others do. This result is in line with findings reported by for example, Harvey and Voelker [17] in Benin, Clark et al [18] in the Western Palearctic, and Bodawatta et al [19] in both New Guinea and the Canary Islands. Despite these differences being observed across diverse regions, the factors that may affect the haemosporidian prevalence at the host family level have not yet been identified [20].…”

“…The host-parasite network in Sardinia indicated a high value of the specificity H 2 index (0.756), which suggests that the Sardinian host-parasite community is specialized, and this result differs from the more generalized host-parasite community observed in the Canary and New Guinea Islands [19]. These different community structures could be due to the differences in bird species and environmental diversity: i.e., the Canary Islands are smaller and contain fewer breeding species than Sardinia, while the more diverse bird community in New Guinea was sampled over a long elevational gradient (from 200 to 3700 m asl).…”

“…An extensive literature which comprises both single-species [9,10] and multi-species/communities' studies [11,12] also points to a very complicated framework affected by intertwined ecological factors, to include host-parasite relationships [13,14], host ecological or ethological traits [15], insect vector abundance [16] and climate influence [17]. Moreover, the framework is further complicated by unique dynamics, inherent to the biogeographic region in which studies are conducted, such as isolation-colonization events [18,19]. Thus, studies from new regions may be useful in disentangling the determining factors influencing haemosporidian infections and allowing assessments of whether those factors are generalized (e.g., similar across regions) or unique [18].…”

The drivers of avian‐haemosporidian prevalence in tropical lowland forests of New Guinea in three dimensions

“…We then proceeded with the second PCRs targeting specific haemosporidian genera ( Haemoproteus and Plasmodium) , using HaemR2 (5′‐GCATTATCTGGATGTGATAATGGT‐3′) and HaemF (5′‐ATGGTGCTTTCGATATGCATG‐3′) primers (Hellgren et al, 2004 ). We did not investigate Leucocytozoon parasites due to their low prevalence in New Guinea (Bodawatta et al, 2020 ). The second PCR was set up using 10 μl of Qiagen multiplex master mix (Hilden, Germany), 1 μl of 10 mM concentration of each primer, and 8 μl of 10× diluted product from the first PCR.…”

More than meets the eye: decrypting diversity reveals hidden interaction specificity between frogs and frog‐biting midges

“…Realised specificity can also be largely determined by the presence and abundance of suitable hosts (Poulin, 2011a) and their encounter probability (Combes, 1991), governed by spatiotemporal dynamics (e.g. Krasnov et al ., 2004; Bodawatta et al ., 2020).…”