Speciation Versus Phenotypic Plasticity in Coral Inhabiting Barnacles: Darwin's Observations in an Ecological Context

Mokady, Ofer; Loya, Yossi; Achituv, Y.; Geffen, Eli; Graur, Dan; Rozenblatt, Shmuel; Brickner, Itzchak

doi:10.1007/pl00006560

Cited by 46 publications

(24 citation statements)

References 18 publications

(20 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Speciation by differential host adaptation under similar scenario is widely observed in other symbiotic barnacles (e.g. [14], [15], [16]). On the other hand, if the selection pressure is more gentle (i.e.…”

Section: Introductionsupporting

confidence: 59%

Host-Specific Phenotypic Plasticity of the Turtle Barnacle Chelonibia testudinaria: A Widespread Generalist Rather than a Specialist

et al. 2013

View full text Add to dashboard Cite

Turtle barnacles are common epibionts on marine organisms. Chelonibia testudinaria is specific on marine turtles whereas C. patula is a host generalist, but rarely found on turtles. It has been questioned why C. patula, being abundant on a variety of live substrata, is almost absent from turtles. We evaluated the genetic (mitochondrial COI, 16S and 12S rRNA, and amplified fragment length polymorphism (AFLP)) and morphological differentiation of C. testudinaia and C. patula from different hosts, to determine the mode of adaptation exhibited by Chelonibia species on different hosts. The two taxa demonstrate clear differences in shell morphology and length of 4–6th cirri, but very similar in arthropodal characters. Moreover, we detected no genetic differentiation in mitochondrial DNA and AFLP analyses. Outlier detection infers insignificant selection across loci investigated. Based on combined morphological and molecular evidence, we proposed that C. testudinaria and C. patula are conspecific, and the two morphs with contrasting shell morphologies and cirral length found on different host are predominantly shaped by developmental plasticity in response to environmental setting on different hosts. Chelonibia testudinaria is, thus, a successful general epibiotic fouler and the phenotypic responses postulated can increase the fitness of the animals when they attach on hosts with contrasting life-styles.

show abstract

Section: Introductionsupporting

confidence: 59%

Host-Specific Phenotypic Plasticity of the Turtle Barnacle Chelonibia testudinaria: A Widespread Generalist Rather than a Specialist

et al. 2013

View full text Add to dashboard Cite

show abstract

“…Polymerase chain reaction (PCR) products for three mitochondrial genes - partial 16S rDNA (∼460 bp; using the primer 16sf-cray [19] and 16s-1472r [18]), partial COI (∼659 bp; with primers LCO1-1490 and HCO1-2198 [20]), and partial 12S rDNA (∼390 bp; using the primers 12sf and 12sr [21]) - were amplified using protocols following Porter et al [17] and Crandall & Fitzpatrick [18]. We also PCR amplified the partial nuclear gene 28S rDNA (∼800–1000 bp; with primers 28s-rd3a and 28s-rD5b [22], [23] or with primers made for this study 28sF-cray 5′- TCGTCGGCTGTCGGCTGGGT -3′ and 28sR-cray 5′- CTAGATGGTTCGATTAGTCTTTC -3′ using an annealing temp of 65°C).…”

Section: Methodsmentioning

confidence: 99%

Testing Phylogenetic Hypotheses of the Subgenera of the Freshwater Crayfish Genus Cambarus (Decapoda: Cambaridae)

2012

View full text Add to dashboard Cite

BackgroundThe genus Cambarus is one of three most species rich crayfish genera in the Northern Hemisphere. The genus has its center of diversity in the Southern Appalachians of the United States and has been divided into 12 subgenera. Using Cambarus we test the correspondence of subgeneric designations based on morphology used in traditional crayfish taxonomy to the underlying evolutionary history for these crayfish. We further test for significant correlation and explanatory power of geographic distance, taxonomic model, and a habitat model to estimated phylogenetic distance with multiple variable regression.Methodology/Principal FindingsWe use three mitochondrial and one nuclear gene regions to estimate the phylogenetic relationships for species within the genus Cambarus and test evolutionary hypotheses of relationships and associated morphological and biogeographical hypotheses. Our resulting phylogeny indicates that the genus Cambarus is polyphyletic, however we fail to reject the monophyly of Cambarus with a topology test. The majority of the Cambarus subgenera are rejected as monophyletic, suggesting the morphological characters used to define those taxa are subject to convergent evolution. While we found incongruence between taxonomy and estimated phylogenetic relationships, a multiple model regression analysis indicates that taxonomy had more explanatory power of genetic relationships than either habitat or geographic distance.ConclusionsWe find convergent evolution has impacted the morphological features used to delimit Cambarus subgenera. Studies of the crayfish genus Orconectes have shown gonopod morphology used to delimit subgenera is also affected by convergent evolution. This suggests that morphological diagnoses based on traditional crayfish taxonomy might be confounded by convergent evolution across the cambarids and has little utility in diagnosing relationships or defining natural groups. We further suggest that convergent morphological evolution appears to be a common occurrence in invertebrates suggesting the need for careful phylogenetically based interpretations of morphological evolution in invertebrate systematics.

show abstract

“…Some phenotypic plasticity is clearly adaptive (Dodson 1989, Scharloo 1989, Newman 1992; however this is difficult to demonstrate empirically (Newman 1992, Dudley & Schmitt 1996. Common in terrestrial taxa, phenotypic plasticity has also been documented in a broad range of marine biota including fishes (Robinson & Wilson 1995, Turigan et al 1995, Vanrooij et al 1995, molluscs (Etter 1996, Trussell 1996, crustaceans (Lively 1986, Hazlett 1995, Mokady et al 1999, echinoderms (Ebert 1996), sponges (Palumbi 1984), bryozoans (Harvell 1992, Okamura 1992 and corals (Foster 1979, Bruno & Edmunds 1997, Muko et al 2000.…”

Section: Introductionmentioning

confidence: 99%

Genotype × environment interactions in transplanted clones of the massive corals Favia speciosa and Diploastrea heliopora

Todd¹,

Ladle²,

Lewin-Koh³

et al. 2004

Mar. Ecol. Prog. Ser.

View full text Add to dashboard Cite

Environment-dependent variation in the morphological, physiological, or behavioural expression of a genotype is termed phenotypic plasticity. To test for small-scale morphological plasticity in the Indo-Pacific massive corals Favia speciosa (Dana, 1846) and Diploastrea heliopora (Lamark, 1816), fragments (clone-mates) from 12 colonies of each species were reciprocally transplanted among 6 new habitats located within 2 environmental gradients: a depth cline and a nearshore-to-offshore gradient in sedimentation rates and total suspended solids (TSS). After 7 mo, all fragments were collected, cleared of tissue, and 10 morphometric characters extracted from randomly chosen corallites. Reaction norms, analysis of variance, and canonical discriminant analysis describe environmentinduced changes in corallite architecture. These changes are more pronounced in the depth cline than along the sediment gradient. Similarity of response is suggested by exploratory factor analysis where, for both species, size attributes dominate the first factor, antisymmetry the second, and corallite exsertion the third. Highly significant genotype × environment interactions for F. speciosa indicate that, for this species, genotypes vary in the level of plasticity expressed. Light and TSS emerge as the primary correlates influencing morphological change, although other parameters might act additively, synergystically or antagonistically with them. In shallow waters, increased corallite exsertion may enhance light capture or, alternatively, protect the central (oral disc) area of each polyp from harmful UV radiation. Morphological variability, combined with environment-induced changes in pigmentation, could impede accurate identification of these taxa.

show abstract

Speciation Versus Phenotypic Plasticity in Coral Inhabiting Barnacles: Darwin's Observations in an Ecological Context

Cited by 46 publications

References 18 publications

Host-Specific Phenotypic Plasticity of the Turtle Barnacle Chelonibia testudinaria: A Widespread Generalist Rather than a Specialist

Host-Specific Phenotypic Plasticity of the Turtle Barnacle Chelonibia testudinaria: A Widespread Generalist Rather than a Specialist

Testing Phylogenetic Hypotheses of the Subgenera of the Freshwater Crayfish Genus Cambarus (Decapoda: Cambaridae)

Genotype × environment interactions in transplanted clones of the massive corals Favia speciosa and Diploastrea heliopora

Contact Info

Product

Resources

About