Species composition and distribution of Coleosporium species on the needles of Pinus densiflora at a semi-natural vegetation succession site in central Japan

Suzuki, Hiroyuki; Hirose, Dai; Yamaoka, Yuichi

doi:10.1016/j.myc.2018.04.001

Cited by 5 publications

(16 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This was further demonstrated by Suzuki et al. ( 2018 ), who noted the presence of P. amurense at a distance of 200 m southwest of the study site (the Sugadaira Research Station, Mountain Science Center, University of Tsukuba, Japan) where this pathogen was by far the most abundant on a Japanese red pine forest.…”

Section: Pest Categorisationsupporting

confidence: 68%

“…The basidiospores germinate and develop germ tubes infecting needles of the aecial hosts ( Pinus spp. ), where this pathogen overwinters (Suzuki et al., 2018 ). Aecial hosts include Pinus densiflora Siebold and Zucc.…”

Section: Pest Categorisationmentioning

confidence: 99%

“…A polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP) approach has been proposed by Suzuki et al. ( 2018 ) to distinguish four Coleosporium species affecting pine trees in Central Japan, namely C. asterum, C. clematidis‐apiifoliae, C. lycopodis and C. phellodendri , the latter being the most abundantly distributed throughout the sites studied in Japan. The protocol includes the use of primer pair 5.8 s‐coleo (50‐CACATCGATGAAGAACACAGTG‐30) and itsr‐coleo (50‐CGGACTCCTGTAAAGAGCCA‐30) to amplify the ITS2 region, followed by digestion of the amplicon with a set of restriction enzymes.…”

Section: Pest Categorisationmentioning

confidence: 99%

See 2 more Smart Citations

Pest categorisation of Coleosporium phellodendri

Bragard¹,

Baptista²,

Chatzivassiliou³

et al. 2022

EFS2

View full text Add to dashboard Cite

The EFSA Plant Health Panel performed a pest categorisation of Coleosporium phellodendri Kom., a basidiomycete fungus belonging to the order Pucciniales, causing rust diseases on Pinus spp. (aecial host) and on Phellodendron spp. (telial host). C. phellodendri has been reported only from Asia (namely, China, Republic of Korea, Japan and Russia) and is not known to be present in the EU territory. The pathogen is not listed in Annex II of Commission Implementing Regulation (EU) 2019/2072, an implementing act of Regulation (EU) 2016/2031, or in any emergency plant health legislation. The pathogen could enter into, become established in, and spread within the EU territory via host plants for planting and host plant parts (e.g. foliage, branches) other than seeds and fruits, respectively. Spread within the EU territory may also occur by natural means if Phellodendron spp. were present. Availability of the Pinus spp. and climate suitability factors occurring in the EU are favourable for the establishment of the pathogen in areas where Phellodendron spp. are also present. Phytosanitary measures are available to prevent the introduction and spread of the pathogen in the EU. C. phellodendri does not satisfy all the criteria assessed by EFSA for consideration as a Union quarantine pest as no economic and environmental impact of this pathogen is expected without widespread presence of Phellodendron spp. in the EU.

show abstract

Section: Pest Categorisationsupporting

confidence: 68%

Section: Pest Categorisationmentioning

confidence: 99%

Section: Pest Categorisationmentioning

confidence: 99%

See 1 more Smart Citation

Pest categorisation of Coleosporium phellodendri

Bragard¹,

Baptista²,

Chatzivassiliou³

et al. 2022

EFS2

View full text Add to dashboard Cite

show abstract

“…Differently, C. phellodendri remains in the needles for about 18 months, with no external symptoms, a minimal development and an unclear infection potential during that period (Suzuki et al, 2018).…”

Section: Pra Informationmentioning

confidence: 99%

“…The needles of the host pines can be infected both symptomatically and asymptomatically (asymptomatic during autumn and winter) (Suzuki et al, 2018). The commodity has needles at the time of export.…”

Section: Evidence That the Commodity Is A Pathwaymentioning

confidence: 99%

Commodity risk assessment of bonsai plants from China consisting of Pinus parviflora grafted on Pinus thunbergii

Bragard¹,

Baptista²,

Chatzivassiliou³

et al. 2022

EFS2

View full text Add to dashboard Cite

The European Commission requested the EFSA Panel on Plant Health to prepare and deliver a scientific opinion on the risk posed by bonsai plants from China consisting of Pinus parviflora grafted on Pinus thunbergii taking into account the available scientific information, including the technical information provided by China. All pests associated with P. parviflora and/or P. thunbergii were evaluated against specific criteria for their relevance for this Scientific Opinion. Forty‐three pests that fulfilled all relevant criteria were selected for further evaluation. For 24 pests that are not quarantine in the EU, the risk mitigation measures described in the technical dossier from China were evaluated taking into account the possible limiting factors. For these pests, an expert judgement is given on the likelihood of pest freedom taking into consideration the risk mitigation measures acting on the pest, including uncertainties associated with the assessment. While the estimated degree of pest freedom varied among pests, Setoptus parviflorae was the pest most frequently expected on the commodity. The Expert Knowledge Elicitation indicated, with 95% certainty, that 9,114 or more bonsai plants per 10,000 will be free from Setoptus parviflorae. For 19 pests that are quarantine in the EU, the implementation of specific measures defined in point 30 and 31 of Annex VII of Commission Implementing Regulation (EU) 2019/2072 was evaluated. The requirements of point 31 are met, whereas those of point 30 are not completely fulfilled.

show abstract

Mongolian pine forest decline by the combinatory effect of European woodwasp and plant pathogenic fungi

Wang

YouQing

et al. 2021

Sci Rep

View full text Add to dashboard Cite

Interactions between the decline of Mongolian pine woodlands and fungal communities and invasive pests in northeastern China are poorly understood. In this study, we investigated the fungal communities occurring in three tree samples: the woodwasp Sirex noctilio infested, healthy uninfested and unhealthy uninfested Mongolian pine trees. We analyzed the relationships of the Mongolian pine decline with fungal infection and woodwasp infestation. Twenty-six fungal species were identified from the sampled trees. Each tree sample harbored a fungal endophyte community with a unique structure. Pathogenic fungi richness was four times higher in infested and unhealthy un-infested trees compared to that in healthy uninfested trees. Sphaeropsis sapinea was the most dominant pathogenic fungus in the sampled Mongolian pine trees. The number of S. noctilio was higher than native bark beetles in the declining Mongolian pine trees. The invasion of the woodwasp appeared to be promoted by the fungal infection in the Mongolian pine trees. The incidence of S. noctilio infestation was higher in the fungi infected trees (83.22%) than those without infection (38.72%). S. sapinea population exhibited positive associations with within-tree colonization of S. noctilio and bark beetle. Collectively, these data indicate that the fungal disease may have caused as the initial reason the decline of the Mongolian pine trees, and also provided convenient conditions for the successful colonization of the woodwasp. The woodwasps attack the Mongolian pine trees infected by fungi and accelerated its decline.

show abstract

Species composition and distribution of Coleosporium species on the needles of Pinus densiflora at a semi-natural vegetation succession site in central Japan

Cited by 5 publications

References 24 publications

Pest categorisation of Coleosporium phellodendri

Pest categorisation of Coleosporium phellodendri

Commodity risk assessment of bonsai plants from China consisting of Pinus parviflora grafted on Pinus thunbergii

Mongolian pine forest decline by the combinatory effect of European woodwasp and plant pathogenic fungi

Contact Info

Product

Resources

About