Species identification and authentification of human and rodent cell cultures using polymerase chain reaction analysis of vomeronasal receptor genes

Holder, Michelle J.; Cooper, Paul R.

doi:10.1007/s10616-011-9394-1

Cited by 3 publications

(4 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To assess this, we employed a species-specific PCR assay targeting the transcripts encoding vomeronasal receptors. This approach was selected because the assay had been validated in earlier work as a sensitive means to probe for species contamination in cell culture systems 28 . Accordingly, genomic DNA was extracted from 1.1B4 cells passaged for different periods and employed as template to amplify target vomeronasal receptor sequences using rat or human-specific primers.…”

Section: Resultsmentioning

confidence: 99%

Investigation of the utility of the 1.1B4 cell as a model human beta cell line for study of persistent enteroviral infection

Chaffey

Young

Kaiyven

et al. 2021

Sci Rep

View full text Add to dashboard Cite

The generation of a human pancreatic beta cell line which reproduces the responses seen in primary beta cells, but is amenable to propagation in culture, has long been an important goal in diabetes research. This is particularly true for studies focussing on the role of enteroviral infection as a potential cause of beta-cell autoimmunity in type 1 diabetes. In the present work we made use of a clonal beta cell line (1.1B4) available from the European Collection of Authenticated Cell Cultures, which had been generated by the fusion of primary human beta-cells with a pancreatic ductal carcinoma cell, PANC-1. Our goal was to study the factors allowing the development and persistence of a chronic enteroviral infection in human beta-cells. Since PANC-1 cells have been reported to support persistent enteroviral infection, the hybrid 1.1B4 cells appeared to offer an ideal vehicle for our studies. In support of this, infection of the cells with a Coxsackie virus isolated originally from the pancreas of a child with type 1 diabetes, CVB4.E2, at a low multiplicity of infection, resulted in the development of a state of persistent infection. Investigation of the molecular mechanisms suggested that this response was facilitated by a number of unexpected outcomes including an apparent failure of the cells to up-regulate certain anti-viral response gene products in response to interferons. However, more detailed exploration revealed that this lack of response was restricted to molecular targets that were either activated by, or detected with, human-selective reagents. By contrast, and to our surprise, the cells were much more responsive to rodent-selective reagents. Using multiple approaches, we then established that populations of 1.1B4 cells are not homogeneous but that they contain a mixture of rodent and human cells. This was true both of our own cell stocks and those held by the European Collection of Authenticated Cell Cultures. In view of this unexpected finding, we developed a strategy to harvest, isolate and expand single cell clones from the heterogeneous population, which allowed us to establish colonies of 1.1B4 cells that were uniquely human (h1.1.B4). However, extensive analysis of the gene expression profiles, immunoreactive insulin content, regulated secretory pathways and the electrophysiological properties of these cells demonstrated that they did not retain the principal characteristics expected of human beta cells. Our data suggest that stocks of 1.1B4 cells should be evaluated carefully prior to their use as a model human beta-cell since they may not retain the phenotype expected of human beta-cells.

show abstract

Section: Resultsmentioning

confidence: 99%

Investigation of the utility of the 1.1B4 cell as a model human beta cell line for study of persistent enteroviral infection

Chaffey

Young

Kaiyven

et al. 2021

Sci Rep

View full text Add to dashboard Cite

show abstract

“…To carry out this analysis, we utilized a fresh aliquot of CM that had never been used to culture enteroids. Following DNA isolation from the medium, we carried out PCR using mouse-specific primers for the V1rh10 gene as previously described by others (Holder and Cooper, 2011) and detected murine DNA in the CM (Figure 1). To confirm the finding that murine DNA was detected in L-WRN-cultured organoids only, we identified V1rh10 amplification in samples of cultured colonoids and enteroids; the matched primary tissue samples did not amplify this marker (Figure 1).…”

Section: Resultsmentioning

confidence: 99%

“…Commercial PCR analysis was performed by Charles River Laboratories according to their Cell Line Examination and Report with Infectious Disease PCR Panel (CLEAR PCR Panel, Charles River Laboratories). PCR analysis of conditioned medium for mouse-specific V1rh10 was conducted utilizing primers specified by Holder and Cooper (2011) (Forward: TTCAGGGTGCTATGGGAGGGGC Reverse: GCCCATCCCTGTGAATCAGCACA, 300 bp product). Primers were produced by IDT technologies, and 32 cycles of 10 ng DNA reactions were completed at 60°C annealing temperature on C1000 Touch Thermal Cycler (M0488S, Bio-Rad) using One Taq Hot Start Quick-Load PCR kit (New England BioLabs).…”

Section: Methodsmentioning

confidence: 99%

Low-Level Mouse DNA in Conditioned Medium Generates False Positive Cross-Species Contamination Results in Human Organoid Cultures

Bohm

Dame

Boyd

et al. 2020

Front. Cell Dev. Biol.

View full text Add to dashboard Cite

Cell line authentication is critical for preventing the use of mixed or misidentified cell lines in research. Current efforts include short tandem repeat (STR) analysis and PCRbased assays to detect mixed species cultures. Using PCR analysis with mouse-specific primers, we identified contaminating mouse DNA in growth factor conditioned medium (CM) derived from the L-WRN cell line (L-WRN CM), as well as in human organoid cultures maintained in the L-WRN CM. DNA isolated from L-WRN CM matched the L-WRN cell signature by STR analysis. Organoid lines that were positive for murine DNA by PCR were further analyzed via bulk RNA-sequencing and transcripts were aligned to the human and mouse genomes. RNA analysis failed to detect mouse-specific gene expression above background levels, suggesting no viable murine cells were present in the organoid cultures. We interpret our data to show conclusive evidence that mouse cell-derived CM can be a source of contaminating murine DNA detected in human organoid cultures, even though live, transcriptionally-active murine cells are not present. Together, our findings suggest that multiple methods may be required to authenticate human organoid or cell lines and urges cautious interpretation of DNA-based PCR cell line authentication results.

show abstract

“…Even an extensive array containing over 600,000 mouse SNPs (Yang et al 2009 ) is still unable to identify individual mice within the same subspecies. Species specific primers have been used to determine the origin of species for cell lines (Higgins et al 2010 ; Steube et al 2008 ; Holder and Cooper 2011 ); however, they lack specificity to identify down the individual level. This report describes an assay that can be used to authenticate mouse cell lines resulting in unique profiles for individual mouse samples based on tetranucleotide repeats that are stable with high passage number in the two different cell lines tested.…”

Section: Introductionmentioning

confidence: 99%

Mouse cell line authentication

Almeida

Hill²,

Cole³

2013

Cytotechnology

View full text Add to dashboard Cite

The scientific community has responded to the misidentification of human cell lines with validated methods to authenticate these cells; however, few assays are available for nonhuman cell line identification. We have developed a multiplex polymerase chain reaction assay that targets nine tetranucleotide short tandem repeat (STR) markers in the mouse genome. Unique profiles were obtained from seventy-two mouse samples that were used to determine the allele distribution for each STR marker. Correlations between allele fragment length and repeat number were determined with DNA Sanger sequencing. Genotypes for L929 and NIH3T3 cell lines were shown to be stable with increasing passage numbers as there were no significant differences in fragment length with samples of low passage when compared to high passage samples. In order to detect cell line contaminants, primers for two human STR markers were incorporated into the multiplex assay to facilitate detection of human and African green monkey DNA. This multiplex assay is the first of its kind to provide a unique STR profile for each individual mouse sample and can be used to authenticate mouse cell lines.

show abstract

Species identification and authentification of human and rodent cell cultures using polymerase chain reaction analysis of vomeronasal receptor genes

Cited by 3 publications

References 31 publications

Investigation of the utility of the 1.1B4 cell as a model human beta cell line for study of persistent enteroviral infection

Investigation of the utility of the 1.1B4 cell as a model human beta cell line for study of persistent enteroviral infection

Low-Level Mouse DNA in Conditioned Medium Generates False Positive Cross-Species Contamination Results in Human Organoid Cultures

Mouse cell line authentication

Contact Info

Product

Resources

About