Species-specific detection of Candida tropicalis using evolutionary conserved intein DNA sequences

Abstract

Development of molecular markers for specific detection of microbial pathogens using real-time polymerase chain reaction (PCR) is an appealing and challenging technique. A real-time PCR is an emerging technology frequently used to detect the aetiologic agents. In recent times, designing species-specific primers for pathogen detection is gaining momentum. The method offers rapid, accurate and cost-effective strategy to identify the target, thus providing sufficient time to instigate appropriate chemotherapy. The study highlights the use of intein DNA sequence as molecular markers for species-specific identification of Candida tropicalis. The study also offers a prototype model for developing multifaceted PCR assays using intein DNA sequences, and provides a developmental starting point for point-of-care testing in near future.

Multilocus sequence typing (MLST) analysis reveals many novel genotypes and a high level of genetic diversity in Candida tropicalis isolates from Italy and Africa

“…Before molecular characterisation and MLST genotyping, the identity of all C. tropicalis isolates was phenotypically confirmed by subculture on CHROMagar Candida medium (CHROMagar, France). Definitive species identification was established by using a simple PCR‐based assay developed for rapid and easy identification of C. tropicalis 29 . This method is based on the specie‐specific amplification of a 245 bp DNA fragment from the vacuolar membrane ATPase (VMA) intein gene using only a single pair of primers: VMA‐f: AATCCGAAGGCTTGATGG and VMA‐r: AATGCCAGCAGCAAAAGTAG 29 …”

“…Genomic DNA was isolated according to Müller et al, 1998 30 by using the high‐speed glass bead‐beating method combined with the conventional phenol‐chloroform‐isoamyl alcohol extraction and ethanol precipitation. In vitro amplifications were carried out in 50 μl reaction volumes using the DreamTaq Green PCR master mix (Thermo Fisher Scientific, Milan, Italy) supplemented with 0.5 μg of genomic DNA template and 0.5 μM of each VMA primer described above 29 …”

“…PCRs were performed in a MyCycler thermal cycler (Bio‐Rad, Milan, Italy) using the following conditions: initial denaturation at 95°C for 5 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 53°C for 40 sec and extension at 72°C for 45 sec, and a final extension step of 7 min at 72°C. PCR products were then analysed by 2% w/v agarose gel electrophoresis to confirm the presence of the expected 245 bp amplicon 29 …”

“…Definitive species identification was established by using a simple PCR‐based assay developed for rapid and easy identification of C. tropicalis . 29 This method is based on the specie‐specific amplification of a 245 bp DNA fragment from the vacuolar membrane ATPase (VMA) intein gene using only a single pair of primers: VMA‐f: AATCCGAAGGCTTGATGG and VMA‐r: AATGCCAGCAGCAAAAGTAG. 29 …”

“… 29 This method is based on the specie‐specific amplification of a 245 bp DNA fragment from the vacuolar membrane ATPase (VMA) intein gene using only a single pair of primers: VMA‐f: AATCCGAAGGCTTGATGG and VMA‐r: AATGCCAGCAGCAAAAGTAG. 29 …”