Specific Inhibition of ICAM-1 Expression Mediated by Gene Targeting with Triplex-forming Oligonucleotides

Abstract

Selected sequences in the DNA double helix can be specifically recognized by oligonucleotides via hydrogen bonding interactions. The resulting triple helix can modulate DNA metabolism and especially interfere with transcription in a gene-specific manner. To explore the potential of triplex-forming oligonucleotides (TFOs) as gene repressors, a TFO was designed to target a 16-bp sequence within the third intron of the human intercellular-adhesion molecule-1 (ICAM-1) gene, which plays a key role in initiating inflammation. TFO binding to its ICAM-1 target sequence was characterized in vitro and also demonstrated in cell nuclei with the set-up of a novel magnetic capture assay, which represents a general experimental approach to the detection of specific TFO binding and to the determination of the accessibility of a given genomic DNA locus. In a human keratinocyte cell line (A431), we observed that: (i) the ICAM-1 target sequence in the chromatin context within the nuclei is still available for triplex formation and (ii) TFO inhibits sequence and gene-specific interferon-␥-induced ICAM-1 surface expression. Collectively, the data demonstrate effective and specific inhibition of ICAM-1 expression by TFO treatment and support the view that triplex-mediated gene targeting might be a valuable technique for anti-inflammatory or anticancer strategies.

Combination Analysis of Activator Protein-1 Family Members, Sp1 and an Activator Protein-2α-Related Factor Binding to Different Regions of the Urokinase Receptor Gene in Resected Colorectal Cancers

“…It is possible to screen larger patient series for a predominantly tumor-specific binding of transcription factors, allowing conclusions as to which u-PARregulatory pathways may be preferred in the individual patient. This strategy may allow the selection of individualized specific targeting approaches (51), for the individual inhibition of u-PAR-mediated invasion. Similar individualized targeting based on the status of molecular regulators will most certainly affect clinical tumor staging and tumor therapy in the following years.…”

Inhibition of urokinase-type plasminogen activator receptor induces apoptosis in melanoma cells by activation of p53

“…Quantitative PCR was performed using the FastStart DNA Master SYBR Green I Kit (Roche) with 2 ml of cDNA and 10 pmol of each primer as described. 44 Relative gene expression was expressed as a ratio of the expression level of the gene of interest to that of Hypoxanthine-phosphoribosyl-transferase (HPRT) RNA determined in the same sample. Reaction conditions were 4 mM MgCl 2 (951C for 10 s, 611C for 15 s, 721C for 30 s) for uPAR (P1: GCTGTACCCACTCAGAGAAGAC; P2: GTCACCACATCCAGGCACTGTT), 2 mM MgCl 2 (951C for 10 s, 551C for 15 s, 721C for 15 s) for IFNa (P1: GTGAGGAAATACTTCCAAAGAATCAC; P2: TCTCATGATTTCTGCTCTGACAA) and 2 mM MgCl2, (951C for 10 s, 501C for 15 s, 721C for 25 s) for HPRT (P1: GACTTTGCTTTCCTTGGTCA; P2: GGCTTTGTATTTTGCTTTTCC).…”

Bioconjugation of Oligonucleotides for Treating Liver Fibrosis

“…However, these methods are not quantitative. New methods have been developed based on PCR, including competitive PCR (396), linear amplified primer extension (382), single-strand ligation PCR (402), and real-time PCR-based methods (398,405,406). Currently, interests are focused on the detection and quantification of triplex formation in the native chromatin structures rather than on isolated DNA targets and plasmids.…”

“…The degree of triplex formation was 0% to 50% in permealized cells depending on the genes of interest and gene expression status (398). Besch et al developed a real-time PCR-based method in combination with DNA capture using magnetic beads (405,406). In this method, TFO was modified with psoralen at one end and biotin at the other end for capture.…”