Stable Hg(II)-mediated base pairs with a phenanthroline-derived nucleobase surrogate in antiparallel-stranded DNA

Abstract

Metal-mediated base pairs involving artificial nucleobases have emerged as a promising means for the site-specific functionalization of nucleic acids with metal ions. In this context, a GNA-appended (GNA: glycol nucleic acid) nucleoside analogue containing the artificial nucleobase 1H-imidazo[4,5-f][1,10]phenanthroline (P) has already been applied successfully in a variety of homo-and heteroleptic metal-mediated base pairs, mainly involving Ag(I) ions. Herein, we report a thorough investigation of the Hg(II)-binding properties of P when incorporated into antiparallel-stranded DNA duplexes. The artificial nucleobase P is able to form Hg(II)-mediated homoleptic base pairs of the type P-Hg(II)-P with a [2 + 2] coordination environment. In addition, the heteroleptic P-Hg(II)-T pair was investigated. The addition of a stoichiometric amount of Hg(II) to a duplex comprising either a P:P pair or a P:T pair stabilizes the DNA duplex by 4.3 °C and 14.5 °C, respectively. The P-Hg(II)-T base pair, hence, represents the most stabilizing non-organometallic Hg(II)-mediated base pair reported to date. The formation of the Hg(II)-mediated base pairs was investigated by means of temperature-dependent UV spectroscopy and CD spectroscopy. Graphic abstractKeywords Nucleic acid · Metal-mediated base pair · Phenanthroline · Mercury

Acyclic Nucleic Acids with Phosphodiester Linkages—Synthesis, Properties and Potential Applications

“…5′-d(AAAAAAAAAPTAATTTTPAATATTT)-3′/ 3′-d(TTTTTTTTTCATTAAAATTTATAAA)-5′ it was possible to selectively load one modified base pair (P:T ) with Hg +2 and the other (P:C) with Ag + . A similar phenomenon was observed for a duplex 5′-d(GAGGGAPAGAAAG)-3′/3′-d(CTCCCTPTCTTTC)-5′ (a P:P base pair), where ΔTm = 4.3 °C was observed after addition of the Hg 2+ cation, although ΔTm = 14.5 °C was observed for a P:T base pair [54].…”

Chiral‐at‐Metal Silver‐Mediated Base Pairs: Metal‐Centred Chirality versus DNA Helical Chirality

“…[12] Later, the preference for a single isomer inside the DNA duplex was confirmed for other metal-mediated homo base pairs of P, involving the metal ions Cu I , Zn II , and Hg II . [14] In all cases, CD spectra clearly indicated that the metal-mediated base pair was indeed the isomer shown on the right-hand side of Figure 1b. Interestingly, this preference was observed irrespective of whether (R)-P or (S)-P were introduced as nucleoside analogues into the DNA duplex, despite their different behaviour outside of DNA.…”

Organomercury Nucleic Acids: Past, Present and Future

“…[72][73][74][75] Such base pairs typically feature a dicoordinate bridging Hg II and a linear coordination geometry although with artificial nucleobase surrogates higher coordination numbers have been reported as well. [76] Various applications for coordinative Hg II -mediated base pairing are under active development, [63] ranging from sensors for Hg II [77][78][79][80][81] to molecular wires. [82] High affinity, rapid association and dissociation [83] and responsiveness of nucleic acid secondary structure to subtle changes in the binding mode [84] make Hg IImediated base pairs attractive components for the construction of DNA nanostructures.…”

“…Most of the research efforts have been directed at coordinative Hg II ‐mediated base pairs, in particular the T‐Hg II ‐T homo base pair [72–75] . Such base pairs typically feature a dicoordinate bridging Hg II and a linear coordination geometry although with artificial nucleobase surrogates higher coordination numbers have been reported as well [76] . Various applications for coordinative Hg II ‐mediated base pairing are under active development, [63] ranging from sensors for Hg II[77–81] to molecular wires [82] .…”