Staurosporine Induces Formation of Two Types of Extra-Long Cell Protrusions: Actin-Based Filaments and Microtubule-Based Shafts

Abstract

Staurosporine (STS) has been known as a classic protein kinase C inhibitor and is a broad-spectrum inhibitor targeting over 250 protein kinases. In this study, we observed that STS treatment induced drastic morphologic changes, such as elongation of a very large number of nonbranched, actin-based long cell protrusions that reached up to 30 mm in an hour without caspase activation or PARP cleavage in fibroblasts and epithelial cells. These cell protrusions were elongated not only from the free cell edge but also from the cell-cell junctions. The elongation of STS-dependent protrusions was required for ATP hydrolysis and was dependent on myosin-X and fascin but independent of Cdc42 and VASP. Interestingly, in the presence of an actin polymerization inhibitor, namely, cytochalasin D, latrunculin A, or jasplakinolide, STS treatment induced excess tubulin polymerization, which resulted in the formation of many extra-long microtubule (MT)-based protrusions toward the outside of the cell. The unique MT-based protrusions were thick and linear compared with the STS-induced filaments or stationary filopodia. These protrusions, which were composed of microtubules, have been scarcely observed in cultured non-neuronal cells. Taken together, our findings revealed that STS-sensitive kinases are essential for the maintenance of normal cell morphology, and a common unidentified molecular mechanism is involved in the formation of the following two different types of protrusions: actin-based filaments and MT-based shafts.

Myosin-X is essential to the intercellular spread of HIV-1 Nef through tunneling nanotubes

“…Moreover, while a group in 2017 found, using quantitative lipid MS, that global PS levels are not affected by either Nef or SERINC5 expression (Trautz et al 2017), those findings do not preclude the possibility that Nef might induce a translocation of PS to the outer leaflet and/ or that Nef microdomains in the plasma membrane may cause a localized loss of PS which then recruits TNT complex proteins thereby enhancing the formation of TNTs. Remarkably, cells stressed with low levels of staurosporine display long, thin, Myo10-dependent protrusions (Kohno et al 2015) that exhibit a striking translocation of PS to their outer membrane (Waehrens et al 2009). Thus, the absence of PS in specific microdomains on the inner leaflet might be a requirement for Myo10-dependent TNT formation.…”

Staurosporine Induces Filamentation in the Human Fungal Pathogen Candida albicans via Signaling through Cyr1 and Protein Kinase A

“…The profound impact of staurosporine on cellular morphology extends beyond the fungal kingdom. Staurosporine induces cellular elongation in cultured mammalian cells ( 44 ), suggesting that the relevant target of staurosporine is conserved from yeast to humans. Notably, in mammalian cells, staurosporine induces actin reorganization independently of protein kinase C ( 45 ).…”

Translocation of LSR from tricellular corners causes macropinocytosis at cell–cell interface as a trigger for breaking out of contact inhibition

“…The following siRNAs targeting human gene were used: LSR (siLSR (1), 5′‐CCCACGCAACCCAUCGUCAUCUGGA‐3′; siLSR (2), 5′‐GGCCGGAGGAUUACCAUCAUCACCGGA‐3′), SLC9A1 (siSLC9A1 (1), 5′‐GCACCAUUCGAAGCUCAGATT‐3′), and control RNA (siControl, 5′‐AUUGUCAUUCAUGACGUGGUAAUCA‐3′) were purchased from Thermo Fisher Scientific; SLC9A1 (siSLC9A1 (2), 5′‐UGCGGGCUACUUCCUGCCACU‐3′), JNK (VHS40722, Stealth RNAi), and scrambled control (SIC001) were purchased from Sigma‐Aldrich. Expression vectors for GFP‐Rac and GFP‐DN‐Rac (T17N) were constructed as described previously 24 . For RNA interference experiments, cells were seeded on a 24‐well culture plate or a glass base dish and simultaneously transfected with siRNA using RNAiMAX (Thermo Fisher Scientific) according to the manufacturer's instructions.…”

“…Expression vectors for GFP-Rac and GFP-DN-Rac (T17N) were constructed as described previously. 24 For RNA interference experiments, cells were seeded on a 24-well culture plate or a glass base dish and simultaneously transfected with siRNA using RNAiMAX (Thermo Fisher Scientific) according to the manufacturer's instructions. For plasmid transfection, cells were seeded on a glass base dish, cultured for 24 h, and transiently transfected with ViaFect (Promega, Madison, WI, USA) according to the manufacturer's instructions.…”

“…Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) samples were prepared as described previously. 24 For TEM, cells grown on an 8-well chamber slide were treated with reagent as indicated and then fixed in an equal volume of 0.1-M PBS (pH 7.3) containing 5% glutaraldehyde and left overnight at 4°C. Specimens were then stained and analyzed using a transmission electron microscope (H7500; Hitachi, Tokyo, Japan) operating at 80 kV.…”