Strain-induced mechanotransduction through primary cilia, extracellular ATP, purinergic calcium signaling, and ERK1/2 transactivates CITED2 and downregulates MMP-1 and MMP-13 gene expression in chondrocytes

He, Zelai; Leong, Daniel J.; Zhuo, Zewei; Majeska, Robert J.; Cardoso, Luís; Spray, David C.; Goldring, Mary B.; Cobelli, Neil J.; Sun, Hui

doi:10.1016/j.joca.2015.11.015

Cited by 64 publications

(70 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…eccentric loading) may reflect a decrease in the mechanosensitivity of tendon cells secondary to a hypoxic environment 9 . Primary cilia are mechanosensitive organelles that can detect mechanical environmental changes 10 and are found in musculoskeletal tissue cell types, including tenocytes, osteocytes, and chondrocytes [10][11][12][13][14] . Passive cilia bending is required for mechanosensation of mechanical perturbations, with elongated cilia more sensitive to loading than shorter cilia 15 .…”

Section: Introductionmentioning

confidence: 99%

Hypoxia inhibits primary cilia formation and reduces cell-mediated contraction in stress-deprived rat tail tendon fascicles

Lavagnino

Oslapas

Gardner

et al. 2016

MLTJ

View full text Add to dashboard Cite

SummaryBackground: Hypoxia, which is associated with chronic tendinopathy, has recently been shown to decrease the mechanosensitivity of some cells. Therefore, the purpose of this study was to determine the effect of hypoxia on the formation of elongated primary cilia (a mechanosensing organelle of tendon cells) in vitro and to determine the effect of hypoxia on cell-mediated contraction of stress-deprived rat tail tendon fascicles (RTTfs). Methods: Tendon cells isolated from RTTfs were cultured under normoxic (21% O2) or hypoxic (1% O2) conditions for 24 hours. The cells were then stained for tubulin and the number of cells with elongated cilia counted. RTTfs from 1-month-old male Sprague-Dawley rats were also cultured under hypoxic and normoxic conditions for three days and tendon length measured daily. Results: A significant (p=0.002) decrease in the percent of elongated cilia was found in cells maintained in hypoxic conditions (54.1%±12.2) when compared in normoxic conditions (71.7%±6.32). RTTfs in hypoxia showed a significant decrease in the amount of contraction compared to RTTfs in normoxia after two (p=0.007) and three (p=0.001) days. Conclusion:The decreased incidence of elongated primary cilia in a hypoxic environment, as well as the decreased mechanoresponsiveness of tendon cells under these conditions may relate to the inability of some cases of chronic tendinopathy to respond to strain-based rehabilitation modalities (i.e. eccentric loading).

show abstract

Section: Introductionmentioning

confidence: 99%

Hypoxia inhibits primary cilia formation and reduces cell-mediated contraction in stress-deprived rat tail tendon fascicles

Lavagnino

Oslapas

Gardner

et al. 2016

MLTJ

View full text Add to dashboard Cite

show abstract

“…Transfection efficiency was monitored based on quantification of transfected green fluorescence labeled irrelevant siRNA by FACS analysis in a parallel experiment. Primary human chondrocytes were isolated from cartilage discarded from knee replacement surgeries under IRB‐approved protocols, cultured as above in the presence of IL‐1β (10 ng/mL), and used for experiments within passages 1 or 2, as described …”

Section: Methodsmentioning

confidence: 99%

“…Real‐time PCR was performed to determine relative gene expression using SYBR green (Bio‐Rad) and gene‐specific primers, as follows: CITED2‐F: TGGGCGAGCACATACACTAC, CITED2‐R: GGTAGGGGTGATGGTTGAAA; MMP13‐F: ACTGAGAGGCTCCGAGAAATG, MMP13‐R: GAACCCCGCATCTTGGCTT; GAPDH‐F: CATGGAGAAGGCTGGGGCTCATTTG, GAPDH‐R: GGGGTGCTAAGCAGTTGGTGGT. Relative gene expression was calculated using the ΔΔ C T method …”

Section: Methodsmentioning

confidence: 99%

CITED2 mediates the cross‐talk between mechanical loading and IL‐4 to promote chondroprotection

Leong

et al. 2019

Annals of the New York Academy of Sciences

View full text Add to dashboard Cite

Osteoarthritis (OA) pathogenesis is mediated largely through the actions of proteolytic enzymes such as matrix metalloproteinase (MMP) 13. The transcriptional regulator CITED2, which suppresses the expression of MMP13 in chondrocytes, is induced by interleukin (IL)‐4 in T cells and macrophages, and by moderate mechanical loading in chondrocytes. We tested the hypothesis that CITED2 mediates cross‐talk between IL‐4 signaling and mechanical loading‐induced pathways that result in chondroprotection, at least in part, by downregulating MMP13. IL‐4 induced CITED2 gene expression in human chondrocytes in a dose‐ and time‐dependent manner through JAK/STAT signaling. Mechanical loading combined with IL‐4 resulted in additive effects on inducing CITED2 expression and downregulating of MMP13 in human chondrocytes in vitro. In vivo, IL‐4 gene knockout (KO) mice exhibited reduced basal levels of CITED2 expression in chondrocytes. While moderate treadmill running induced CITED2 expression and reduced MMP13 expression in wild‐type mice, these effects were blunted (for CITED2) or abolished (for MMP13) in chondrocytes of IL‐4 gene KO mice. Moreover, intra‐articular injections of mouse recombinant IL‐4 combined with regular cage activity mitigated post‐traumatic OA to a greater degree compared to immobilized mice treated with IL‐4 alone. These data suggest that using moderate loading to enhance IL‐4 may be a potential therapeutic strategy for chondroprotection in OA.

show abstract

“…Chondrocytes were isolated from human patients who underwent knee replacement surgery ( n = 4, females, ages 49–64), as described previously [16,82]. Chondrocytes were cultured in Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) supplemented with 10% fetal bovine serum (FBS), at 37 °C, 5% CO 2 .…”

Section: Methodsmentioning

confidence: 99%

“…After three cycles of freeze and thaw, total protein contained in the supernatants was obtained by centrifuge at 12,000× g at 4 °C for 15 min. Western blots were performed as previously described [82]. Briefly, approximately 10 µg of protein (from cartilage extracts or cell lysate) was separated by sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) gel electrophoresis in a 4%–20% gradient polyacrymide gel (Bio-Rad Laboratories), and transferred to a polyvinalidene diflouride membrane (PVDF) membrane (Bio-Rad Laboratories).…”

Section: Methodsmentioning

confidence: 99%

Procyanidins Mitigate Osteoarthritis Pathogenesis by, at Least in Part, Suppressing Vascular Endothelial Growth Factor Signaling

Wang

Leong

et al. 2016

IJMS

View full text Add to dashboard Cite

Procyanidins are a family of plant metabolites that have been suggested to mitigate osteoarthritis pathogenesis in mice. However, the underlying mechanism is largely unknown. This study aimed to determine whether procyanidins mitigate traumatic injury-induced osteoarthritis (OA) disease progression, and whether procyanidins exert a chondroprotective effect by, at least in part, suppressing vascular endothelial growth factor signaling. Procyanidins (extracts from pine bark), orally administered to mice subjected to surgery for destabilization of the medial meniscus, significantly slowed OA disease progression. Real-time polymerase chain reaction revealed that procyanidin treatment reduced expression of vascular endothelial growth factor and effectors in OA pathogenesis that are regulated by vascular endothelial growth factor. Procyanidin-suppressed vascular endothelial growth factor expression was correlated with reduced phosphorylation of vascular endothelial growth factor receptor 2 in human OA primary chondrocytes. Moreover, components of procyanidins, procyanidin B2 and procyanidin B3 exerted effects similar to those of total procyanidins in mitigating the OA-related gene expression profile in the primary culture of human OA chondrocytes in the presence of vascular endothelial growth factor. Together, these findings suggest procyanidins mitigate OA pathogenesis, which is mediated, at least in part, by suppressing vascular endothelial growth factor signaling.

show abstract

Strain-induced mechanotransduction through primary cilia, extracellular ATP, purinergic calcium signaling, and ERK1/2 transactivates CITED2 and downregulates MMP-1 and MMP-13 gene expression in chondrocytes

Cited by 64 publications

References 46 publications

Hypoxia inhibits primary cilia formation and reduces cell-mediated contraction in stress-deprived rat tail tendon fascicles

Hypoxia inhibits primary cilia formation and reduces cell-mediated contraction in stress-deprived rat tail tendon fascicles

CITED2 mediates the cross‐talk between mechanical loading and IL‐4 to promote chondroprotection

Procyanidins Mitigate Osteoarthritis Pathogenesis by, at Least in Part, Suppressing Vascular Endothelial Growth Factor Signaling

Contact Info

Product

Resources

About