Streptococcus suis Encodes Multiple Allelic Variants of a Phase-Variable Type III DNA Methyltransferase, ModS, That Control Distinct Phasevarions

Abstract

Streptococcus suis is a significant cause of bacterial meningitis in humans, particularly in Southeast Asia, and is a leading cause of respiratory and invasive disease in pigs. Phase-variable DNA methyltransferases, associated with restriction-modification (R-M) systems, are a source of epigenetic gene regulation, controlling the expression of multiple genes. These systems are known as phasevarions (phase-variable regulons) and have been characterized in many host-adapted bacterial pathogens. We recently described the presence of a Type III DNA methyltransferase in S. suis, ModS, which contains a simple sequence repeat (SSR) tract within the open reading frame of the modS gene and which differed in length between individual strains. We also observed that multiple allelic variants of the modS gene were present in a population of S. suis isolates. Here, we demonstrate that a biphasic ON-OFF switching of expression occurs in the two most common ModS alleles, ModS1 and ModS2, and that switching is dependent on SSR tract length. Furthermore, we show using single-molecule real-time (SMRT) sequencing that ModS1 and ModS2 are active methyltransferases in S. suis. ON-OFF switching of each ModS allele results in the regulation of distinct phasevarions, with the ModS2 phasevarion impacting growth patterns and antibiotic resistance. This is the first demonstration of a phase-variable Type III DNA methyltransferase in a Gram-positive organism that controls a phasevarion. Characterizing the phenotypic effects of phasevarions in S. suis is key to understanding pathogenesis and the development of future vaccines. IMPORTANCE Streptococcus suis is a causative agent of meningitis, polyarthritis, and polyserositis in swine, and it is a major cause of zoonotic meningitis in humans. Here, we investigate epigenetic gene regulation in S. suis by multiple phasevarions controlled by the phase-variable Type III DNA methyltransferase ModS. This is the first characterized example of a Type III R-M system regulating a phasevarion in a Gram-positive organism. We demonstrate that biphasic ON-OFF switching of ModS expression results in differences in bacterial growth and antibiotic resistance. Understanding the effects of ModS phase variation is required to determine the stably expressed antigenic repertoire of S. suis, which will direct and inform the development of antimicrobial treatments and vaccines against this important pathogen.

Pneumococcal Phasevarions Control Multiple Virulence Traits, Including Vaccine Candidate Expression

“…Phasevarions have been characterized in many bacterial pathogens such as Neisseria spp. ( 17 ), Moraxella catarrhalis ( 18 ), Haemophilus influenzae ( 19 , 20 ), and Streptococcus suis ( 21 ). In every case, phasevarions regulate genes involved in pathobiology, and frequently genes encoding vaccine candidates.…”

Actinobacillus pleuropneumoniaeencodes multiple phase-variable DNA methyltransferases that comprise distinct phasevarions

“…All the Type III mod genes we identified contained a simple DNA sequence repeat tract within the open reading frame of each mod gene (23). All previously characterised mod genes containing SSRs have been shown to be phase-variable, and to control a phasevarion (26,28–30,40). Analysis of the sequences of the Type III mod genes we identified in A. pleuropneumoniae demonstrated the presence of two separate, unrelated phase-variable mod genes, which we named modP and modQ .…”

“…Following this novel finding, we wanted to determine if ModP1 and ModP2 phase-variable expression resulted in the regulation of different phasevarions, i.e., did cytosine methylation at different motifs result in different sets of proteins being regulated commensurate with the observed phase variation? To quantify the extent of differential protein expression mediated by ModP1 and ModP2 phase variation, we carried out quantitative SWATH proteomics, used previously to characterise expression differences mediated by phase-variable DNA methyltransferases (40). The expression profiles of the ModP1 ON-OFF pair (10 repeats ON and 11 repeats OFF) and ModP2 ON-OFF pair (25 repeats ON and 24 repeats OFF) were assessed by SWATH-MS proteomics.…”

“…This analysis demonstrated that both ModP1 and ModP2 are cytosine specific Type III DNA methyltransferases, each recognising and methylating a different DNA target sequence. ModP1 methylates a cytosine in the motif CAA (m4) CT , and ModP2 methylates a cytosine in the motif GWC( m4 )CT. by ModP1 and ModP2 phase variation, we carried out quantitative SWATH proteomics, used previously to characterise expression differences mediated by phase-variable DNA methyltransferases(40). The expression profiles of the ModP1 ON-OFF pair (10 repeats ON and 11 repeats OFF) and ModP2 ON-OFF pair (25 repeats ON and 24 repeats OFF) were assessed by SWATH-MS proteomics.…”

Characterization of the Phase-Variable Autotransporter Lav Reveals a Role in Host Cell Adherence and Biofilm Formation in Nontypeable Haemophilus influenzae

“…Bacterial genomic DNA from invasive isolates was prepared as described previously ( 27 ). Standard methods were used throughout for PCR using GoTaq Flexi DNA polymerase according to the manufacturer’s instructions (Promega), and fragment analysis was carried out as previously described ( 45 ). lav ON/OFF status was determined from the number of GCAA repeats in the SSR tract present in the gene (based on amplicon peak size), using Lav_F (6-carboxyfluorescein [FAM]– GCCCCATTTATTTTTACTTGACAAAGG ) and Lav_R ( GCTCATTTGTTAATTTAGAATTGTCATAAG ) primers.…”