Structural Characterization of Penicillin-Binding Protein-Related Factor A (PrfA) from Bacillus Species

Kelly, Stephen; Bagyan, Irina; Setlow, Peter; Jedrzejas, Mark J.

doi:10.1006/jsbi.2000.4280

Cited by 5 publications

(11 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The B. subtilis and B. stearothermophilus prfA genes have been cloned into an E. coli expression strain, and the resulting overexpressing proteins were purified to homogeneity as previously described (Kelly et al 2000; Pedersen and Setlow 2000). The purity of the final purified PrfA proteins was greater than 98%, as judged by SDS‐PAGE analysis.…”

Section: Methodsmentioning

confidence: 99%

“…The sequence of this primer was 5′GTACTTG CC GCGG TACACACCGTTGTAGGCGGTCGTCG; the nucleotide changed is underlined, and a Sac II site in this primer also present in the prfA gene is in bold face. PCR‐using plasmid pPS3248 (Kelly et al 2000) carrying the B. stearothermophilus prfA gene as a template with these two primers gave the expected 283‐bp fragment that was cloned in plasmid pCR2.1 (Invitrogen); one plasmid with the expected insert was identified by DNA sequence analysis, and was named pPS3464. A ∼270‐bp fragment was excised from this plasmid by digestion with Nco I and Sac II and cloned between the Nco I and Sa cII sites in plasmid pPS3248 (after removal of the wild‐type 270‐bp Nco I ‐Sac II fragment) in E. coli TG1 giving strain PS3465.…”

Section: Methodsmentioning

confidence: 99%

“…A ∼270‐bp fragment was excised from this plasmid by digestion with Nco I and Sac II and cloned between the Nco I and Sa cII sites in plasmid pPS3248 (after removal of the wild‐type 270‐bp Nco I ‐Sac II fragment) in E. coli TG1 giving strain PS3465. The plasmid in this strain has the mutated prfA gene inserted in plasmid pET9d (Kelly et al 2000). Prior to expression of the mutant PrfA, the plasmid from strain PS3465 was transformed into E. coli BL21 (DE3 pLysS) giving strain PS3466, which was the strain used for overexpression of the D86A PrfA variant.…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

PrfA protein of Bacillus species: Prediction and demonstration of endonuclease activity on DNA

Rigden¹,

Setlow

et al. 2002

Protein Science

Self Cite

View full text Add to dashboard Cite

The prfA gene product of Gram-positive bacteria is unusual in being implicated in several cellular processes; cell wall synthesis, chromosome segregation, and DNA recombination and repair. However, no homology of PrfA with other proteins has been evident. Here we report a structural relationship between PrfA and the restriction enzyme PvuII, and thereby produce models that predict that PrfA binds DNA. Indeed, wild-type Bacillus stearothermophilus PrfA, but not a catalytic site mutant, nicked one strand of supercoiled plasmid templates leaving 5Ј-phosphate and 3Ј-hydroxyl termini. This activity, much lower on linear or relaxed circular double-stranded DNA or on single-stranded DNA, is consistent with a role for this protein in chromosome segregation, DNA recombination, or DNA repair.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

PrfA protein of Bacillus species: Prediction and demonstration of endonuclease activity on DNA

Rigden¹,

Setlow

et al. 2002

Protein Science

Self Cite

View full text Add to dashboard Cite

show abstract

“…Mutation analysis of this two gene operon show that the mutation of prfA gene alone in B. subtilis causes a ~twofold decrease in cell growth rate, a severe defect in nucleoid segregation during cell division, and a prfA/ponA double mutant was found to severely limit cell growth (Pedersen and Setlow, 2000). The PBP1 protein was found to associate with the cell wall and membrane; however, thẽ 20 kDa recombinant PrfA was found to be a soluble protein when overexpressed in Escherichia coli (Kelly et al, 2000). PBP1 was localized at division sites in …”

Section: Examples Of Homology Studies Improved Functional Annotmentioning

confidence: 97%

“…Such candidate proteins include, for example, cofactor independent phosphoglycerate mutase (iPGM), germination protease (GPR) (Ponnuraj et al, 2000a,b;Ponnuraj et al, 1999), penicillin-binding protein-related factor A endonuclease (PrfA-endonuclease) (Rigden et al, 2002b;Kelly et al, 2000), and NAD + synthetase (NADS) (Devedjiev et al, 2001). The availability of genomic sequence of B. subtilis and other spore-forming bacterial allowed for the additional identification of numerous other proteins that are uniquely essential for this group of bacteria.…”

Section: Spore-forming Bacteriamentioning

confidence: 99%

BacillusSpecies Proteins Involved in Spore Formation and Degradation: From Identification in the Genome, to Sequence Analysis, and Determination of Function and Structure

Jedrzejas¹,

Huang²

2003

Critical Reviews in Biochemistry and Molecular Biology

View full text Add to dashboard Cite

The members of Bacillus species are Gram-positive, ubiquitous spore-forming bacilli. Several genomic sequences have been made available during recent years, including Bacillus subtilis, a model organism among this genus, Bacillus anthracis, and their analyses provided a wealth of information about spore-forming bacteria. Some members of this species can cause serious diseases in livestock and humans. An important pathogen in this group of organisms is B. anthracis, which is the causative agent of anthrax. A summary of the B. subtilis genome information, based on the publicly released sequence, that allowed for the identification and characterization of new and novel proteins of this organism as well as similar proteins from other members of Bacillus species is provided. The primary goal for this work is to present a review of the genome sequence-identified genes that encode proteins involved in the sporulation, germination, and outgrowth processes. These three processes are essential for spore development and later its transformation into a vegetative cell. Additionally, for a few selected examples of the protein products of the identified genes, the application of bioinformatics and modeling tools is illustrated in order to determine their likely structure and function. Two three-dimensional models of the structures of such proteins, PrfA endonuclease and phosphatase PhoE, are presented together with the structure-based functional conclusions. The review of such studies provides an example of how the genomic sequence can be utilized in order to elucidate the structure and function of proteins, in particular proteins of the Bacillus species. Because only a limited number of proteins of Bacillus species organisms are involved in the synthesis and degradation of spores and have been characterized to date, this genome-based analysis may provide new insights into the developmental processes of bacterial organism.

show abstract

Structure, flexibility, and mechanism of the Bacillus stearothermophilus RecU holliday junction resolvase

Kelly¹,

Li²,

Setlow

et al. 2007

Proteins

Self Cite

View full text Add to dashboard Cite

Here we report a high resolution structure of RecU-Holliday junction resolvase from Bacillus stearothermophilus. The functional unit of RecU is a homodimer that contains a "mushroom" like structure with a rigid cap and two highly flexible loops extending outwards. These loops appear to be highly flexible/dynamic, and presumably are directly involved in DNA binding and holding it for catalysis. Structural modifications of both the protein and DNA upon their interaction are essential for catalysis. An Mg2+ ion is present in each of the two active sites in this homodimeric enzyme, and two water molecules are coordinated with each Mg2+ ion. Our data are consistent with one of these water molecules acting as a nucleophile and the other as a general acid. The identities of the general base and general acid involved in catalysis and the Lewis acid that stabilizes the pentacovalent transition state phosphate ion are proposed. A model for the RecU-Holliday junction DNA complex is also proposed and discussed in the context of DNA binding and cleavage.

show abstract

Structural Characterization of Penicillin-Binding Protein-Related Factor A (PrfA) from Bacillus Species

Cited by 5 publications

References 20 publications

PrfA protein of Bacillus species: Prediction and demonstration of endonuclease activity on DNA

PrfA protein of Bacillus species: Prediction and demonstration of endonuclease activity on DNA

BacillusSpecies Proteins Involved in Spore Formation and Degradation: From Identification in the Genome, to Sequence Analysis, and Determination of Function and Structure

Structure, flexibility, and mechanism of the Bacillus stearothermophilus RecU holliday junction resolvase

Contact Info

Product

Resources

About