Structural Organization of the Human Prostaglandin EP3Receptor Subtype Gene (PTGER3)

Kotani, Masato; Tanaka, Issei; Ogawa, Yoshihiro; Usui, Takeshi; Tamura, Naohisa; Mori, Kiyoshi; Narumiya, Shuh; Takai, Yoshimi; Nakao, Kazuwa

doi:10.1006/geno.1996.4585

Cited by 96 publications

(79 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This predicts membership of the TPs in the family of GPCRs, consistent with their biochemical characteristics (32). It appears that the TP is subject to alternative splicing in the carboxyl-terminal region, as has been previously described for E prostaglandin receptor type 3 (33). Little is known about the functional significance of this observation.…”

Section: Effect Of Protein Kinase a Inhibition On U46619-dependentsupporting

confidence: 68%

Rapid, Agonist-dependent Phosphorylation in Vivo of Human Thromboxane Receptor Isoforms

Habib

Vezza

Créminon

et al. 1997

Journal of Biological Chemistry

View full text Add to dashboard Cite

Section: Effect Of Protein Kinase a Inhibition On U46619-dependentsupporting

confidence: 68%

Rapid, Agonist-dependent Phosphorylation in Vivo of Human Thromboxane Receptor Isoforms

Habib

Vezza

Créminon

et al. 1997

Journal of Biological Chemistry

View full text Add to dashboard Cite

“…Primer sequences for the amplification of the EP 1 , EP 2 , and EP 4 receptors 34 are as follows, reading from the 5Ј to the 3Ј direction: EP 1 , sense ATCTGCTGGAGGCCAATGCTGGTGT, antisense TCGTTGGGCCTCT-GGTTGTGCTT; EP 2 , sense CCTGGCCGTGCTGCCTGTCATCTAT, antisense CCATGGACACCCTTTCCCTCTCCT; and EP 4 , sense TTTG-CAGGCCATCCGAATTGCTTCT, antisense CCTGCCTCCAAGGC-CATTTTCACTGG. Because the human EP 3 receptor gene gives rise to several splice variants, 35,36 we designed primers for the selective amplification of each. Splice variants I to IV were amplified using a common sense strand primer (CTGAACCAGATCTTGGATCC) with the following isoformspecific antisense primers: EP 3 -I, TCACCATCATAAGCTTATAC; EP 3 -II, TACGAATGGCAGACTCAACA; and EP 3 -III and EP 3 -IV, TCATGGAGCT-TCCAGTGATG.…”

Section: Reverse Transcriptase-polymerase Chain Reaction (Rt-pcr)mentioning

confidence: 99%

Human mast cells express multiple EP receptors for prostaglandin E2 that differentially modulate activation responses

Cheng

Beller

Bagga

et al. 2006

Blood

124

135

View full text Add to dashboard Cite

“…Subtypes of a given receptor can be derived from distinct genes or generated by alternative splicing. Divergence between receptor isoforms, as for the prostaglandin (EP) and the MCP-1 (CCR2) receptors, is most often limited to the carboxyl-terminal cytoplasmic tail, a region that is potentially involved in G-protein coupling, internalization, and down-regulation of the receptors (6,7).…”

mentioning

confidence: 99%

Selective Modulation of Wild Type Receptor Functions by Mutants of G-Protein-coupled Receptors

Gouill

Parent

Caron

et al. 1999

Journal of Biological Chemistry

View full text Add to dashboard Cite

Members of the G-protein-coupled receptor (GPCR)family are involved in most aspects of higher eukaryote biology, and mutations in their coding sequence have been linked to several diseases. In the present study, we report that mutant GPCR can affect the functional properties of the co-expressed wild type (WT) receptor. Mutants of the human platelet-activating factor receptor that fail to show any detectable ligand binding (N285I and K298stop) or coupling to a G-protein (D63N, D289A, and Y293A) were co-expressed with the WT receptor in Chinese hamster ovary and COS-7 cells. In this context, N285I and K298stop mutant receptors inhibited 3 H-WEB2086 binding and surface expression. Co-transfection with D63N resulted in a constitutively active receptor phenotype. Platelet-activating factor-induced inositol phosphate production in cells transfected with a 1:1 ratio of WT:D63N was higher than with the WT cDNA alone but was abolished with a 1:3 ratio. We confirmed that these findings could be extended to other GPCRs by showing that co-expression of the WT C-C chemokine receptor 2b with a carboxyl-terminal deletion mutant (K311stop), resulted in a decreased affinity and responsiveness to MCP-1. A better understanding of this phenomenon could lead to important tools for the prevention or treatment of certain diseases.Certain ligands can assume distinct functions in different tissues. For example, platelet-activating factor (PAF) 1 is involved in embryogenesis as well as in modulation of a variety of functions of the immune and central nervous systems (1-3). With respect to PAF, for which the only known receptor is a member of the G-protein-coupled receptor (GPCR) family, the diversity of responses generated is likely a result of the receptor coupling to different signaling pathways in the target cells (3, 4). On the other hand, for other ligands such as adrenaline and dopamine, the cell can also determine the specificity of its response by the differential expression of receptor subtypes with distinct characteristics of binding, coupling, and desensitization (5). Subtypes of a given receptor can be derived from distinct genes or generated by alternative splicing. Divergence between receptor isoforms, as for the prostaglandin (EP) and the MCP-1 (CCR2) receptors, is most often limited to the carboxyl-terminal cytoplasmic tail, a region that is potentially involved in G-protein coupling, internalization, and down-regulation of the receptors (6, 7).Alternative splicing can also lead to the formation of nonfunctional receptors or receptors with certain functions that are greatly modified (8, 9). Individually, these receptors are not involved in signaling, but some of them can show dominantnegative properties when co-expressed with a functional subtype. It has recently been demonstrated that the expression of a truncated isoform of the human gonadotropin-releasing hormone receptor could affect the extent of agonist-specific cellular response by inhibiting the cell surface expression of the functional isoform (10). A similar e...

show abstract

Structural Organization of the Human Prostaglandin EP3Receptor Subtype Gene (PTGER3)

Cited by 96 publications

References 28 publications

Rapid, Agonist-dependent Phosphorylation in Vivo of Human Thromboxane Receptor Isoforms

Rapid, Agonist-dependent Phosphorylation in Vivo of Human Thromboxane Receptor Isoforms

Human mast cells express multiple EP receptors for prostaglandin E2 that differentially modulate activation responses

Selective Modulation of Wild Type Receptor Functions by Mutants of G-Protein-coupled Receptors

Contact Info

Product

Resources

About