Structural requirements for photo-induced RNA-protein cross-linking

Abstract

Understanding structure-function relationships of RNA-binding proteins requires knowledge of how they bind RNAs in vivo. RNA-protein interactions are studied using light-induced cross-linking at "zerodistance", yielding nucleotide/amino-acid adducts for mass-spectrometry (MS)-based characterization.However, prerequisites for cross-linking are poorly understood, limiting interpretation of cross-linking data. Here, we report novel insights on cross-linking requirements from studying RBFOX-RRM domain bound to 13 C-labeled variants of its heptaribonucleotide binding element as a model. We probed the influence of nucleotide identity, sequence position and amino-acid composition using tandem-MS to assign cross-links at site-specific resolution. We observed cross-linking at three nucleotides, which were stacked onto phenylalanines. Surprisingly, this stacking was required for neighbouring aminoacids to cross-link, and is apparent in published RNA-protein datasets. We hypothesize that πstacking activates cross-linking via electron transfer, whereafter nucleotide-and peptide radicals, possibly stabilized by capto-dative effects, recombine. These findings should facilitate interpretation of cross-linking data from structural studies and genome-wide datasets. has also been observed with proteins that lack canonical RNA binding domains (RBDs) 1 . Taken together, these features render difficult the prediction of an RBP's substrates based only on a computational search for its consensus RBE. Indeed, recent studies of the RBFOX protein family showed that only one half of the isolated RNA targets contain the RBFOX consensus binding motif and that other motifs presumably bear responsibility for some of its splicing activities [10][11][12] .Many state-of-the-art methods to identify RNA-protein interactions in vivo employ RNA-protein crosslinking induced by UV light [13][14][15][16] . For example, by combining UV cross-linking with mass spectrometry approaches, proteins bound to given RNAs can be identified [17][18][19][20][21][22][23][24] . Conversely, UV cross-linking and immunoprecipitation (CLIP) and related protocols are commonly used to identify RNA-binding sites for given proteins on a transcriptome-wide scale [25][26][27][28][29][30] . Technical advances constantly improve these techniques 18,31,32 , however, a long-standing challenge in structure/mechanism-oriented studies is to identify the points of cross-linking on both the RNA and the protein with site-specific resolution.Recently, we introduced cross-linking of segmentally isotope-labelled RNA and tandem mass spectrometry (CLIR-MS), which identifies the sites of amino acid/ribonucleotide cross-links in a single protocol 32 . In CLIR-MS, RNA regions that are suspected to interact with a protein are synthesized in isotopically labelled light-and heavy variants, so that nucleotides involved in cross-linking events appear as peak doublets in the resulting mass spectrum. By focusing on peak doublets during data analysis, cross-linked amino acids and nucleotides are reliabl...

Sensitive detection and structural characterisation of UV-induced cross-links in protein-RNA complexes using CLIR-MS

“…These are well explained by the published structure, with the cross-linked amino acids located on the β-sheet surface of the protein expected to recognise the RNA. Furthermore, these aromatic residues are found π-π stacked with nucleotide bases in the structure, suggesting a close interaction between protein and RNA which may be particularly conducive to cross-linking, as noted elsewhere 53 .…”

“…The distance measurements shown here appear to agree with the chemical structures of cross-linking products proposed in prior literature, which suggests a mechanism for UV-induced protein-RNA cross-linking 36,37 . The chemical mechanism of the reaction remains relatively poorly characterised, and further research in this area (see reference 53 ) will enhance interpretation and utilisation of these data.…”

“…Such technical stratification may unnecessarily reduce signal intensity. Alternative approaches using chemical cleavage of RNA in comparable experimental setups have been recently demonstrated 53,68 , which may reduce the variety of RNA product types, but at the same time result in near-exclusively mononucleotide attachments to peptides. The reduced proportion of polynucleotide adducts resulting from this approach may however make it more challenging to precisely assign the cross-linking site on an RNA sequence, because the data lack the required sequence context on the RNA side.…”

“…13 C 15 N labelling results from transcription of RNA in isotopically labelled cell culture medium, as demonstrated previously 34 . Alternatively, chemically synthesised short RNAs are employed, where RNA is synthesised using 13 C ribonucleotides (also used elsewhere 53 ). 13 C 15 N in vitro transcribed RNA sequences, EMCV IRES RNA (sequence: 5'-GGAUACUGGCCGAAGCCGCUUGGAAUAAGGCCGGUGUGCGUUUGUCUAUAUGUUAUUUU CCACCAUAUUGCCGUCUUUUGGCAAUGUG-3') and U1 snRNP SL4 RNA (sequence: 5'-GGGGACUGCGUUCGCGCUUUCCCC-3') were prepared as described previously 34 .…”

Chemical RNA Cross-Linking: Mechanisms, Computational Analysis, and Biological Applications

“…Converting RNA to cDNA fragments is straightforward, but is impacted by side reactions of cross-linking, which reduce efficiency and accuracy of detecting the cross-linking events. Although more resistant to UV damage than DNA, 106 UVinduced lesions in RNA are commonly observed and include base oxidation (primarily 8-oxoguanine), 107 pyrimidine dimers, 107,108 and adducts with proteins 109,110 and other cellular components (Figure 8). Nitrogen mustards are highly reactive alkylating agents that can cross-link nucleic acids to proteins (Figure 8).…”