Structure and expression of the Aplysia californica calmodulin gene

Swanson, Mark E.; Sturner, Stephen F.; Schwartz, James H.

doi:10.1016/0022-2836(90)90382-v

Cited by 32 publications

(11 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Compared with other invertebrates, the hsCaM differed from that of Patinopecten sp (Toda et al, 1981) ), from that of A. californica (Swanson et al, 1990) and P. fucata (Li et al, 2004), but only by the Thr 144 and Thr 147 residues, respectively. However, the hsCaM is identical with the CaM from Metridium senile (Yuasa et al, 2001).…”

mentioning

confidence: 67%

Molecular characteristics and expression of calmodulin cDNA from the freshwater pearl mussel, Hyriopsis schlegelii

Zeng¹,

Wang²,

Li³

et al. 2012

Genet. Mol. Res.

View full text Add to dashboard Cite

ABSTRACT. Calmodulin (CaM) is a multifunctional intracellular calcium ion receptor protein that participates in a range of cellular processes, including calcium metabolism in mussels. To investigate the role of CaM in freshwater mollusk shell calcium metabolism, the full-length CaM cDNA was isolated from the freshwater pearl mussel, Hyriopsis schlegelii (referred to as hsCaM) using SMART RACE technology. The full-length hsCaM was 855 bp in size, containing a 70-bp 5ꞌ-untranslated sequence, a 447-bp open reading frame, a 309-bp 3ꞌ-untranslated sequence, and a 26-nucleotide long poly(A) tail. The hsCaM mRNA expression in different mussel tissues was examined using real-time PCR. The hsCaM mRNA was found to be ubiquitously expressed, but far more abundant in the gill, foot, and mantle than in the posterior adductor muscle. Real-time PCR was also used to determine hsCaM mRNA expression levels in mantle tissues of H. schlegelii at different ages. No significant differences between one-, two-, and threeyear-old mussels were detected, but expression increased in four-yearold mussels and then decreased in five-year-old mussels. CaM appears to be involved in calcium regulation of the mantle in four-year-old 43 ©FUNPEC-RP www.funpecrp.com.br Genetics and Molecular Research 11 (1): 42-52 (2012) Calmodulin cDNA in Hyriopsis schlegelii mussels, which may secrete more mother of pearl during pearl culture.

show abstract

mentioning

confidence: 67%

Molecular characteristics and expression of calmodulin cDNA from the freshwater pearl mussel, Hyriopsis schlegelii

Zeng¹,

Wang²,

Li³

et al. 2012

Genet. Mol. Res.

View full text Add to dashboard Cite

show abstract

“…A calmodulin nuclear intron situated between exons III and IV (Swanson et al 1990) was amplified using an exonprimed, intron-crossing PCR, with specific primers for Campeloma: Cam-1 (5ЈGATTCTGATGGTATGTTTCTG3Ј) and Cam-2 (5ЈATTTTTGATTGGTTGAAGAG3Ј). These specific primers produced a single, distinct PCR band.…”

Section: Geographic Sampling and Molecular Methodsmentioning

confidence: 99%

Geographic Ranges, Population Structure, and Ages of Sexual and Parthenogenetic Snail Lineages

Johnson¹

2006

Evolution

View full text Add to dashboard Cite

Abstract. Asexual reproduction is thought to doom organisms to extinction due to mutation accumulation and parasite exploitation. Theoretical models suggest that parthenogens may escape the negative effects of conspecifics and biological enemies through escape in space. Through intensive sequencing of a mitochondrial DNA (mtDNA) and a nuclear intron locus in sexual and parthenogenetic freshwater snails (Campeloma), I examine three questions: (1) Are sexual mtDNA lineages more restricted geographically than parthenogenetic mtDNA lineages? (2) Are independent parthenogenetic lineages shorter lived than sexual lineages? and (3) Do parthenogens have higher intraindividual nuclear sequence diversity and form well-differentiated monophyletic groups as expected under the Meselson effect? Geographic ranges of parthenogenetic lineages are significantly larger than geographic ranges of sexual lineages. Based on coalescence times under different demographic assumptions, asexual lineages are short lived, but there is variation in clonal ages. Although alternative explanations exist, these results suggest that asexual lineages may persist in the short term through dispersal, and that various constraints may cause geographic restriction of sexual lineages. Both allotriploid and diploid Campeloma parthenogens have significantly higher allelic divergence within individuals, but show limited nuclear sequence divergence from sexual ancestors. In contrast to previous allozyme evidence for nonhybrid origins of diploid Campeloma parthenogens, cryptic hybridization may account for elevated heterozygosity.

show abstract

“…The hybridization buffer contained 100 mM KCI, 20 mM HEPES (pH 7.0), 1 mM EDTA (Minshull and Hunt 1986). The synthesized oligodeoxynucleotide was complementary to nucleotides 238-261 of the protein-coding region of the Aplysia CaM mRNA (Swanson et al 1990). One volume of 2x RNase H reaction buffer [16 U/ml of RNase H, 100 mM KC1, 40 mM Tris-C1 (pH 7.6), 3 mM MgC12, 100 mg/ml glycogen, 2 mM dithiothrietol (all from Sigma)] was added to each sample.…”

Section: Rnase H Digestion Of Ohgonucleotide-hybridized Rnamentioning

confidence: 99%

Identification of specific mRNAs affected by treatments producing long-term facilitation in Aplysia.

Zwartjes

West

Hattar³

et al. 1998

Learn. Mem.

View full text Add to dashboard Cite

Neural correlates of long-term sensitization of defensive withdrawal reflexes in Aplysia occur in sensory neurons in the pleural ganglia and can be mimicked by exposure of these neurons to serotonin (5-HT). Studies using inhibitors indicate that transcription is necessary for production of long-term facilitation by 5-HT. Several mRNAs that change in response to 5-HT have been identified, but the molecular events responsible for long-term facilitation have not yet been fully described. To detect additional changes in mRNAs, we investigated the effects of 5-HT (1.5 hr) on levels of mRNA in pleural-pedal ganglia using in vitro translation. Four mRNAs were affected by 5-HT, three of which were identified as calmodulin (CaM), phosphoglycerate kinase (PGK), and a novel gene product (protein 3). Using RNase protection assays, we found that 5-HT increased all three mRNAs in the pleural sensory neurons. CaM and protein 3 mRNAs were also increased in the sensory neurons 4Corresponding author.by sensitization training. Furthermore, stimulation of peripheral nerves of pleural-pedal ganglia, an in vitro analog of sensitization training, increased the incorporation of labeled amino acids into CaM, PGK, and protein 3. These results indicate that increases in CaM, PGK, and protein 3 are part of the early response of sensory neurons to stimuli that produce long-term facilitation, and that CaM and protein 3 could have a role in the generation of long-term sensitization.

show abstract

Structure and expression of the Aplysia californica calmodulin gene

Cited by 32 publications

References 30 publications

Molecular characteristics and expression of calmodulin cDNA from the freshwater pearl mussel, Hyriopsis schlegelii

Molecular characteristics and expression of calmodulin cDNA from the freshwater pearl mussel, Hyriopsis schlegelii

Geographic Ranges, Population Structure, and Ages of Sexual and Parthenogenetic Snail Lineages

Identification of specific mRNAs affected by treatments producing long-term facilitation in Aplysia.

Contact Info

Product

Resources

About