Suberoylanilide hydroxamic acid (vorinostat): its role on equine corneal fibrosis and matrix metalloproteinase activity

Donnelly, Kevin S.; Giuliano, Elizabeth A.; Sharma, Ajay; Mohan, Rajiv R.

doi:10.1111/vop.12129

Cited by 22 publications

(22 citation statements)

References 46 publications

(140 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…al. found that SAHA reduced corneal haze in rabbits in vivo following PRK (Bosiack et al 2012, Tandon et al 2012, Donnelly et al 2014). While the efficacy of SAHA as an anti-fibrotic has been repeatedly demonstrated, the precise molecular mechanisms by which it inhibits fibrosis in the cornea have not been extensively investigated so far.…”

Section: Discussionmentioning

confidence: 97%

“…For instance, trichostatin A, an inhibitor of class I and II HDACs, was shown to effectively decrease corneal fibrosis in rabbits in vivo following photorefractive keratectomy surgery (Sharma et al 2009). Another HDACi, suberanilohydroxamic acid (SAHA) which is FDA approved, tested in our laboratory demonstrated significant inhibition of TGF-β1-mediated fibrosis in canine and equine cornea in vitro and rabbit cornea in vivo (Bosiack et al 2012, Tandon et al 2012, Donnelly et al 2014). A recent study from our laboratory found that anti-fibrotic effects of SAHA are partially mediated by the transcriptional repressors 5′TG3′-interacting factors (TGIF) 1 and TGIF2 in human cornea in vitro (Sharma et al 2015).…”

Section: Introductionmentioning

confidence: 97%

See 1 more Smart Citation

Development of a novel in vivo corneal fibrosis model in the dog

Gronkiewicz

Giuliano

Kuroki

et al. 2016

Experimental Eye Research

View full text Add to dashboard Cite

The aim of this study was to develop a novel in vivo corneal model of fibrosis in dogs utilizing alkali burn and determine the ability of suberanilohydroxamic acid (SAHA) to inhibit corneal fibrosis using this large animal model. To accomplish this, we used seven research Beagle dogs. An axial corneal alkali burn in dogs was created using 1 N NaOH topically. Six dogs were randomly and equally assigned into 2 groups: A) vehicle (DMSO, 2 μL/mL); B) anti-fibrotic treatment (50 μM SAHA). The degree of corneal opacity, ocular health, and anti-fibrotic effects of SAHA were determined utilizing the Fantes grading scale, modified McDonald-Shadduck (mMS) scoring system, optical coherence tomography (OCT), corneal histopathology, immunohistochemistry (IHC), and transmission electron microscopy (TEM). The used alkali burn dose to produce corneal fibrosis was well tolerated as no significant difference in mMS scores between control and treatment groups (p=0.89) were detected. The corneas of alkali burned dogs showed significantly greater levels of α-smooth muscle actin, the fibrotic marker, than the controls (p=0.018). Total corneal thickness of all dogs post-burn was significantly greater than baseline OCT images irrespective of treatment (p=0.004); TEM showed that alkali burned corneas had significantly greater minimum and maximum interfibrillar distances than the controls (p=0.026, p=0.018). The tested topical corneal alkali burn dose generated significant opacity and fibrosis in dog corneas without damaging the limbus as evidenced by histopathology, IHC, TEM, and OCT findings, and represents a viable large animal corneal fibrosis in vivo model. Additional in vivo SAHA dosing studies with larger sample size are warranted.

show abstract

Section: Discussionmentioning

confidence: 97%

Section: Introductionmentioning

confidence: 97%

Development of a novel in vivo corneal fibrosis model in the dog

Gronkiewicz

Giuliano

Kuroki

et al. 2016

Experimental Eye Research

View full text Add to dashboard Cite

show abstract

“…β‐actin was used as the housekeeping gene with the forward primer being CGGCTACAGCTTCACCACCA and the reverse primer being CGGGCAGCTCGTAGCTCTTC. These primers had previously been validated on equine corneal cells . The efficacy of each primer was determined by using each PCR primer expression ratio.…”

Section: Methodsmentioning

confidence: 99%

“…Equine corneal research to date has typically been performed using either in vitro model systems or in vivo studies utilizing a low number of animals . In vitro models utilize monocultures of representative corneal cell populations and cannot fully evaluate potential pathologic and toxic changes that may occur in the multilayered cornea.…”

Section: Introductionmentioning

confidence: 99%

Development of a novel ex vivo equine corneal model

Marlo

Giuliano

Sharma

et al. 2016

Veterinary Ophthalmology

Self Cite

View full text Add to dashboard Cite

Objective To develop an ex vivo equine corneal organ culture model. Specifically, to assess the equine cornea's extracellular matrix and cellularity after 7 days using two different culture techniques: either (a) immersion system or (b) air/liquid interface system, to determine the best ex vivo equine corneal model. Methods Fourteen healthy equine corneas with 2 mm of perilimbal sclera were freshly harvested from 7 horses undergoing humane euthanasia. One corneal-scleral ring (CSR) from each horse was randomly placed in the (a) immersion condition organ culture system (IC), with the contralateral SCR being placed in the (b) air/liquid interface organ culture system (ALC) for 7 days. All corneas were evaluated using serial daily gross photography, histology, qPCR and TUNEL assay. Results CSRs placed in the IC (a) had complete loss of corneal transparency on gross photography by 7 days, showed a significant level of corneal stromal disorganization, significantly increased αSMA levels on qPCR, and apoptosis on TUNEL assay compared to controls. The ALC (b), had weak stromal disorganization on histopathologic examination and was not significantly different from normal equine corneal controls on all other evaluated parameters. Conclusions The air-liquid interface organ culture system maintains the equine cornea's extracellular matrix and preserves corneal transparency, while the immersion condition results in near complete degradation of normal equine corneal architecture after 7 days in culture. The air-liquid organ culture is a viable option to maintain a healthy equine cornea in an ex-vivo setting for wound healing studies.

show abstract

“…Once resolved, the cornea is often left with a scar that leads to a reduction in the visual field. Corneal scar formation is a recognized problem afflicting not only horses, but in many of our domestic animal species, as well as people . This loss of corneal transparency can result in a horse being unable to perform its duties such as racing, jumping, or trail riding and can prove to be dangerous to both itself and his/her handler …”

Section: Introductionmentioning

confidence: 99%