Subgenus classification of Acanthamoeba by riboprinting

Abstract

Subgenus classification of Acanthamoeba remains uncertain. Twenty-three reference strains of Acanthamoeba including 18 (neo)type-strains were subjected for classification at the subgenus level by riboprinting. PCR/RFLP analysis of 18S rRNA gene (rDNA). On the dendrogram reconstructed on the basis of riboprint analyses, two type-strains (A. astronyxis and A. tubiashi) of morphological group 1 diverged early from the other strains and were quite distinct from each other. Four type-strains of morphological group 3, A. culbertsoni, A. palestinensis, A. healyi were considered taxonomically valid, but A. pustulosa was regarded as an invalid synonym of A. palestinensis. Strains of morphological group 2 were classified into 6 subgroups. Among them, A. griffini which has an intron in its 18S rDNA was the most divergent from the remaining strains. Acanthamoeba castellanii Castellani, A. quina Vil3, A. lugdunensis L3a, A. polyphaga Jones, A. triangularis SH621, and A. castellanii Ma strains belonged to a subgroup, A. castellanii complex. However, A. quina and A. lugdunensis were regarded as synonyms of A. castellanii. The Chang strain could be regarded as A. hatchetti. Acanthamoeba mauritaniensis, A. divionensis, A. paradivionensis could be considered as synonyms of A. rhysodes. Neff strain was regarded as A. polyphaga rather than as A. castellanii. It is likely that riboprinting can be applied for rapid identification of Acanthamoeba isolated from the clinical specimens and environments.

Acanthamoeba keratitis update—incidence, molecular epidemiology and new drugs for treatment

“…Chung et al 26 identified by riboprinting the 'Chang' strain of A. castellanii (T4 equivalent) from fresh water and found it closely related to A. hatchetti (T11 equivalent) isolated from ocean sediments (salt water); both strains were expected to be pathogenic in animal models. The relationship between Acanthamoeba genotype T4 causing keratitis in humans and T4 isolates from organs of fishes, where its role in surviving without causing disease is that of a protozoon parasite, is intriguing.…”

“…Riboprinting involves PCR followed by RFLP analysis of complete 18S rRNA genes. 12 Although comparisons using all the same strains are unavailable, phylogenetic trees based on RFLP riboprints 12,26 appear to identify clusters of related strains similar to those identified based on DNA sequencing. 18 The use of mitochondrial 16S rDNA for riboprinting has the advantage that it avoids distortions of interstrain relationships caused by introns that occasionally occur in the nuclear 18S rRNA genes of some strains.…”

“…Approaches that have been useful include RFLP analysis of the entire mitochondrial genome, 12,20-25 riboprinting (described below) of 18S rDNA, 12,26 production of typespecific PCR amplimers, [27][28][29][30] analyses based on sequences of subgenic PCR amplimers [30][31][32] as well as the development of fluorescent oligonucleotide probes for in situ staining that are specific either for the genus Acanthamoeba or for genotype T4. 33 The recent introduction of a 'reverse dot-blot' technique holds promise for the eventual simultaneous detection and identification of all rDNA genotypes present in any specimen.…”

Phylogenetic relationships among Acanthamoeba spp. based on PCR-RFLP analyses of mitochondrial small subunit rRNA gene

“…Riboprinting, PCR-RFLP analysis of 18S rDNA, is a simpler and less expensive substitute for 18S rDNA sequence analysis (Clark and Diamond, 1997). Chung et al, (1998) applied riboprinting to subgenus classification of Acantamoeba. The results were congruent with those of sequence analysis.…”

Free-living Amoebae (FLA): morphological and molecular identification ofAcanthamoebain dental unit water

“…P3 (5' CCGAATTCGTCGACAACTGTTGATCCT GCCAGGT 3') and P4 (5' GGATCCAAGCTTGATCCTT CTGCAGGTTCACCTAC 3') (Bhattacharya et al, 1998;Chung et al, 1998). All amplification reactions of PCR were performed in a 50 µl mixture containing 50 ng DNA, 0.2 mM each of dATP, dCTP, dGTP, dTTP, 50 mM of MgCl 2 , 2 µl SAB (serum albumin bovin), 20 pmol of each primer and 2.5 UI of GoTaq DNA polymerase (Promega, Madisson, USA).…”