Substitution of the Rev-response element in an HIV-1-based gene delivery system with that of SIVmac239 allows efficient delivery of Rev M10 into T-lymphocytes

Srinivasakumar, Narasimhachar

doi:10.1186/1742-6405-5-11

Cited by 4 publications

(13 citation statements)

References 34 publications

(47 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In our previous study, we noticed that HIV-1 RRE could be replaced with that of SIVmac239 RRE without a drop in titer [24]. Moreover, this system displayed considerable tolerance to the inhibitory effects of Rev M10.…”

Section: Discussionmentioning

confidence: 98%

See 1 more Smart Citation

Rev-Free HIV-1 Gene Delivery System for Targeting Rev-RRE-Crm1 Nucleocytoplasmic RNA Transport Pathway

Srinivasakumar

2011

PLoS ONE

Self Cite

View full text Add to dashboard Cite

The use of RNA transport elements from different viruses can provide novel attributes to HIV-1-based gene delivery systems such as improved safety or Rev independence. We previously described an HIV-1 based gene delivery system that utilized the simian immunodeficiency virus Rev-response element (RRE) in place of the HIV-1 RRE. Despite the use of Rev for the production of vector stocks, we showed the utility of this system for delivery of Rev M10, a dominant-negative mutant of HIV-1 Rev, into T-cells. Here, we investigated the use of RNA transport elements from Mason-Pfizer monkey virus or MPMV for the creation of high-titered Rev-free HIV-1-based packaging systems. The HIV-1 gag/pol expression constructs containing one or more copies of MPMV constitutive RNA transport element (CTE) were used to package similarly modified gene-transfer vectors in the presence or absence of Rev. An inverse correlation between the number of CTE modules and Rev dependency was noted for vector stock production. While packaging systems containing multiple CTEs were resistant to exogenously expressed Rev M10, the titers of vectors encoding Rev M10 were nevertheless reduced in comparison to vectors encoding only green fluorescent protein (GFP). In contrast, a gene transfer vector encoding the Rev M10 transgene and containing both RNA transport elements exhibited almost no loss in titer in comparison to a corresponding vector encoding only GFP. The optimized Rev-independent gene delivery system was used for delivery of Rev M10 transgene into T-lymphocytes. Upon challenge in single round infection assays with HIV-1, the modified T-cells produced fewer virus particles than control cells expressing GFP. This Rev-free packaging system may prove useful for targeting the Rev-RRE-Crm1 nucleocytoplasmic RNA transport pathway for inhibiting HIV replication.

show abstract

Section: Discussionmentioning

confidence: 98%

“…pGP/HIV 350 RRE and pGP/SIV 1045 RRE have been described earlier [24]. Briefly, these constructs contain the gag/pro-pol coding region including the 5′ splice donor site of the molecular clone pNL4-3 positioned between the human cytomegalovirus immediate early promoter and the bovine growth hormone polyadenylylation site.…”

Section: Methodsmentioning

confidence: 99%

Rev-Free HIV-1 Gene Delivery System for Targeting Rev-RRE-Crm1 Nucleocytoplasmic RNA Transport Pathway

Srinivasakumar

2011

PLoS ONE

Self Cite

View full text Add to dashboard Cite

show abstract

“…For some experiments, in place of pgp3virin, we used an alternative packaging and helper constructs consisting of pGP-HIV-1 350 RRE encoding Gag and Gag-Pro-Pol (1.5 µg), pCMVtat (0.1 µg) and pCI-Rev (0.1 µg) (Srinivasakumar, 2008) for transfection in 6-well plates. Vector stocks were harvested 72 h later, clarified by centrifugation at 2500 × rpm (1400 × g) at 4°C for 15 min and stored at −80°C in aliquots or used immediately for titration on HeLa cells.…”

Section: Methodsmentioning

confidence: 99%

RRE-deleting self-inactivating and self-activating HIV-1 vectors for improved safety

Srinivasakumar

2013

PeerJ

Self Cite

View full text Add to dashboard Cite

Retroviruses have been shown to efficiently delete sequences between repeats as a consequence of the template switching ability of the viral reverse transcriptase. To evaluate this approach for deriving safety-modified lentiviral vectors, we created HIV-1 vectors engineered to delete the Rev-response element (RRE) during reverse-transcription by sandwiching the RRE between two non-functional hygromycin phosphotransferase sequences. Deletion of the RRE during reverse-transcription lead to the reconstitution of a functional hygromycin phosphotransferase gene in the target cell. The efficiency of functional reconstitution, depending on vector configuration, was between 12% and 23%. Real-time quantitative PCR of genomic DNA of cells transduced with the RRE-deleting vectors that were selected using an independent drug resistance marker, which measured both functional and nonfunctional recombination events, indicated that the overall efficiency of RRE deletion of hygromycin phosphotransferase gene, was between 73.6% and 83.5%.

show abstract

“…The sequence similarity between the SIVmac 239 -derived RRE sequence and the HIV-1 RRE sequence is 18.6%. The SIVmac 239 -derived RRE sequence was previously shown to be functionally equivalent to that of the HIV-1 RRE in the context of HIV-1-based lentiviral vectors (Srinivasakumar, 2008). The resulting vector is referred to as NL-SRRE-EGFP(MSCV) (Fig.…”

Section: Design Of Lentiviral Vector Genomes Containing Modified Rre mentioning

confidence: 99%

“…A 1045 bp fragment containing the SIVmac 239 RRE sequence (Srinivasakumar, 2008) was PCR-amplified from plasmid p239SpE3¢ (obtained through the AIDS Research and Reference Reagent Program, Division of AIDS, NIAID, NIH, from Dr. Ronald Desrosiers) (Regier and Desrosiers, 1990) using a forward primer (SIVNotIs: gatcttgcggccgcatcgattggaattgggagatta) and a reverse primer (SRRE1045a2: cgtatcgaccggtctagtta actcagacggcctggaccgcctcatg). The PCR product was digested with NotI and AgeI, and subcloned into NotI-AgeIdigested pNL-RTEmCTE-EGFP(MSCV)/NotI plasmid DNA, to generate pNL-SRRE-EGFP(MSCV).…”

Section: Plasmid Constructsmentioning

confidence: 99%

Analysis of Partial Recombinants in Lentiviral Vector Preparations

Kuate

Marino²,

Reiser³

2014

Human Gene Therapy Methods

View full text Add to dashboard Cite

The presence of replication-competent lentivirus (RCL) in lentiviral vector preparations is a major safety concern for clinical applications of such vectors. RCL are believed to emerge from rare recombinant vector genomes that are referred to as partial recombinants or Psi-Gag recombinants. To quantitatively determine the fraction of partial recombinants in lentiviral vector preparations and to analyze them at the DNA sequence level, we established a drug selection assay involving a lentiviral packaging construct containing a drug-resistance gene encoding blasticidin (BSD) resistance. Upon transduction of target cells, the BSD resistance gene confers BSD resistance to the transduced cells. The results obtained indicate that there were up to 156 BSD-resistant colonies in a total of 10 6 transducing vector particles. The predicted recombination events were verified by polymerase chain reaction using genomic DNA obtained from BSD-resistant cell clones and by DNA sequence analysis. In an attempt to reduce the emergence of partial recombinants, sequence overlaps between the packaging and the vector constructs were reduced by substituting the Rev response element (RRE) present in the vector construct using a heterologous RRE element derived from simian immunodeficiency virus (SIVmac 239 ). The results obtained showed that a reduction of sequence overlaps resulted in an up to sevenfold reduction of the frequency of BSD-resistant colonies, indicating that the capacity to form partial recombinants was diminished.

show abstract

Substitution of the Rev-response element in an HIV-1-based gene delivery system with that of SIVmac239 allows efficient delivery of Rev M10 into T-lymphocytes

Cited by 4 publications

References 34 publications

Rev-Free HIV-1 Gene Delivery System for Targeting Rev-RRE-Crm1 Nucleocytoplasmic RNA Transport Pathway

Rev-Free HIV-1 Gene Delivery System for Targeting Rev-RRE-Crm1 Nucleocytoplasmic RNA Transport Pathway

RRE-deleting self-inactivating and self-activating HIV-1 vectors for improved safety

Analysis of Partial Recombinants in Lentiviral Vector Preparations

Contact Info

Product

Resources

About