Successional changes in bacterial community assemblages following anoxia in the hypolimnion of a eutrophic lake

Abstract

Dynamics of bacterial assemblages following anoxia in the hypolimnion of a eutrophic lake (Lake Aydat) were characterized. The sampling started in spring before complete anoxia and was continued weekly until complete mixing of the water column occurred in autumn. Bacterial community patterns at 3 sampled depths (10, 12 and 14 m) were investigated using temporal temperature gradient gel electrophoresis (TTGE) and terminal restriction fragment length polymorphism (T-RFLP) analyses. Results revealed changes in the structure of the bacterial communities as conditions changed from oxic to anoxic. Once anoxia had been reached, anaerobic bacterial communities continued to change and exhibited gradual successional patterns at the 3 depths. During the anoxic period, bacterial communities at 10 and 12 m were split into 2 groups corresponding to the steps 'until' and 'after' maximum stratification, which occurred on 19 August 2004. While the succession of the bacterial community in the hypolimnion was dynamic and exhibited gradual patterns at the 3 depths, a 'sensitivity gradient' to O 2 depletion was suggested: communities at 10 m appeared to be more affected by the shift in O 2 concentrations than those in deeper water layers.

Resistance, resilience and recovery: aquatic bacterial dynamics after water column disturbance

“…Although many other environmental changes occur during lake overturn that could influence bacterial dynamics (such as temperature, alternative electron acceptor and donor availabilities, and the increased exposure of hypolimnion bacteria to light), we chose to manipulate nutrients and DO because previous studies underscored their general importance for aquatic communities (e.g. Lehours et al ., 2005; 2009; Fenchel and Finlay, 2008; Jones et al ., 2008). We hypothesized that nutrients up‐welled from the hypolimnion promote blooms of quick‐growing microbes, thereby inducing change in the epilimnion community.…”

“…In a stratified water column with high hypolimnion respiration rates, the availability of DO and other respiration substrates commonly structures bacterial communities (e.g. Finlay and Esteban, 2004; Lehours et al ., 2009). When hypolimnion microbial respiration is high, DO is often depleted and is replaced by other respiration substrates in order of their energetic favourability.…”

Distinct and diverse anaerobic bacterial communities in boreal lakes dominated by candidate division OD1

“…Even though there are several studies addressing bacterial communities in humic lakes (for example, Lindströ m, 1998;Burkert et al, 2003;Kent et al, 2004), the microbial diversity and community composition of the suboxic hypolimnetic layers remain poorly explored and the few studies available are typically restricted to very specific questions, sediment communities, or are based on methods that provide little if any information on taxonomy (for example, Kleinsteuber et al, 2008;Lehours et al, 2009;Berdjeb et al, 2011;Taipale et al, 2011) or diversity (Bent et al, 2007). One exception is the recent study by Barberan and Casamayor (2011), which used observations from multiple lakes to demonstrate that microbial communities in the hypolimnia are distinct from those in the epilimnia.…”

Isolation and use of beneficial microbiota from the digestive tract of lions-paw scallopNodipecten subnodosusand winged pearl oysterPteria sternain oyster aquaculture

“…Two kits for extracting DNA (Fast DNA SPIN Kit; MP Biomedicals, Santa Ana, CA, USA) and purifying DNA (Gene‐Clean Kit; MP Biomedicals) were used. The oligos 120F (5′‐actggcggacgggtgagtaa‐3′) and 518R (5′‐cgtattaccgcggctgctgg‐3′) were used for amplifying the V3/V4 region from the 16s rRNA subunits (Lehours, Bardot, Pelisson, Guedon, Pesce, Demeure, Sargos & Fonty ). The products were purified and sequenced by a genomics service provider (GenWiz, South Plainfield, NJ, USA).…”