SUMO paralogue–specific functions revealed through systematic analysis of human knockout cell lines and gene expression data

Abstract

The small ubiquitin-related modifiers (SUMOs) regulate nearly every aspect of cellular function, from gene expression in the nucleus to ion transport at the plasma membrane. In humans, the SUMO pathway has five SUMO paralogs with sequence homologies that range from 45% to 97%. SUMO1 and SUMO2 are the most distantly related paralogs, and also the best studied. To what extent SUMO1, SUMO2 and the other paralogs impart unique and non-redundant effects on cellular functions, however, has not been systematically examined and is therefore not fully understood. For instance, knockout studies in mice have revealed conflicting requirements for the paralogs during development and studies in cell culture have relied largely on transient paralog overexpression or knockdown. To address the existing gap in understanding, we first analyzed SUMO paralog gene expression levels in normal human tissues and found unique patterns of SUMO1-3 expression across 30 tissue types, suggesting paralog-specific functions in adult human tissues. To systematically identify and characterize unique and non-redundant functions of the SUMO paralogs in human cells, we next used CRISPR-Cas9 to knock out SUMO1 and SUMO2 expression in osteosarcoma (U2OS) cells. Analysis of these knockout cell lines revealed essential functions for SUMO1 and SUMO2 in regulating cellular morphology, PML nuclear body structure, responses to proteotoxic and genotoxic stress, and control of gene expression. Collectively, our findings reveal non-redundant regulatory roles for SUMO1 and SUMO2 in controlling essential cellular processes and provide a basis for more precise SUMO-targeting therapies.

SUMO monoclonal antibodies vary in sensitivity, specificity, and ability to detect SUMO conjugate types

“…As SUMO2 is essential in most cell lines (McFarland et al, 2018) and mice (Wang et al, 2014), knockout cells are not commercially available, but have been recently described in U2OS (Bouchard et al, 2021). Our data suggest that many antibodies raised to SUMO2 and SUMO3 are sensitive in some of the detection formats we tested, although different antibodies are preferable for certain modalities (Figure 7).…”

“…SUMO1-3 are processed into mature conjugatable forms through the removal of the extreme C-terminal residues (Mikolajczyk et al, 2007). SUMO1 and SUMO2/3 form two distinct branches of the SUMO system, which use the same conjugation machinery (Wang et al, 2014, Bouchard et al, 2021). SUMO isoforms can be conjugated as monomers, multi-monomers and polymers and can form multiple internal lysine linkage types, including branching and mixed chains comprised of different SUMO isoforms and other Ub/Ubls (Morris and Garvin, 2017).…”

SUMOylation regulates Rb hyperphosphorylation and inactivation in uveal melanoma

“…The following primers were used: SUMO1 (fwd, 5′‐TGACCAGGAGGCAAAACCTTC‐3′; rev, 5′‐AATTCATTGGAACACCCTGTCTT‐3′) and ACTIN (fwd, 5′‐TTGCCGACAGGATGCAGAAG‐3′; rev, 5′‐ACATCTGCTGGAAGGTGGAC‐3′). 25 …”

SUMOylation and NEDDylation in Primary and Metastatic Cancers to Bone

“…SUMO2 and SUMO3 have a specific N-terminus that allows the formation of multimers. SUMO4 and SUMO5 are the least well known SUMO paralogues, although their expression is restricted to specific tissues: SUMO4 is mainly expressed in kidney, spleen and lymph nodes, while SUMO5 is expressed only in few tissues, especially blood and testis ( Bouchard et al, 2021 ; Yuan et al, 2021 ).…”