Surfactin, a quorum sensing signal molecule, globally affects the carbon metabolism in Bacillus amyloliquefaciens

Wen, Jiahong; Zhao, Xiuyun; Si, Fengmei; Qi, Gaofu

doi:10.1016/j.mec.2021.e00174

Cited by 13 publications

(15 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…These signaling molecules lead to an alteration in gene expression, coordination of bacterial behavioural changes, and differentiation into different cell types to adapt environmental changes [ 18 ]. In B. subtilis, surfactin helps to regulate genes that exerts cellular differentiation into different cell types via quorum sensing according to need to adapt adverse condition[ 49 , 17 ].According to some studies, along with cell differentiation surfactin may also have substantial role as a quorum sensing molecule in carbon metabolism [ 52 , 53 ].…”

Section: Effect Of Surfactin On Cell Differentiationmentioning

confidence: 99%

Molecular genetics of surfactin and its effects on different sub-populations of Bacillus subtilis

Rahman

Sarkar

Moni

et al. 2021

Biotechnology Reports

View full text Add to dashboard Cite

show abstract

Section: Effect Of Surfactin On Cell Differentiationmentioning

confidence: 99%

Molecular genetics of surfactin and its effects on different sub-populations of Bacillus subtilis

Rahman

Sarkar

Moni

et al. 2021

Biotechnology Reports

View full text Add to dashboard Cite

show abstract

“…cDNA was produced by reverse transcription with 1 μg RNA, iScript Select cDNA Synthesis Kit and random oligonucleotide primers (Bio-Rad, United States). qRT-PCR was performed with cDNA, SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, United States) and target-specific primers ( Supplementary Table S2 ) in CF96 Real-Time System as following: 1 cycle of 95°C for 5 min, 40 cycles of 95°C for 10 s, 45°C for 20 s and 70°C for 30 s. All expression data were normalized to the copy number of 16S rRNA in each sample ( Wen et al, 2021 ).…”

Section: Methodsmentioning

confidence: 99%

Systemically engineering Bacillus amyloliquefaciens for increasing its antifungal activity and green antifungal lipopeptides production

Wang

Wang²,

Zhao

et al. 2022

Front. Bioeng. Biotechnol.

Self Cite

View full text Add to dashboard Cite

The biosynthesis of antifungal lipopeptides iturin and fengycin has attracted broad interest; however, there is a bottleneck in its low yield in wild strains. Because the key metabolic mechanisms in the lipopeptides synthesis pathway remain unclear, genetic engineering approaches are all ending up with a single or a few gene modifications. The aim of this study is to develop a systematic engineering approach to improve the antifungal activity and biosynthesis of iturin and fengycin in Bacillus amyloliquefaciens. First, blocking the carbon overflow metabolic pathway to increase precursor supply of the branched-chain amino acids by knockout of bdh, disrupting sporulation to extend the stage for producing antifungal lipopeptides by deletion of kinA, blocking of siderophore synthesis to enhance the availability of amino acids and fatty acids by deletion of dhbF, and increasing Spo0A∼P by deletion of rapA, could improve the antifungal activity by 24%, 10%, 13% and 18%, respectively. Second, the double knockout strain ΔbdhΔkinA, triple knockout strain ΔbdhΔkinAΔdhbF and quadruple knockout strain ΔkinAΔbdhΔdhbFΔrapA could improve the antifungal activity by 38%, 44% and 53%, respectively. Finally, overexpression of sfp in ΔkinAΔbdhΔdhbFΔrapA further increased the antifungal activity by 65%. After purifying iturin and fengycin as standards for quantitative analysis of lipopeptides, we found the iturin titer was 17.0 mg/L in the final engineered strain, which was 3.2-fold of the original strain. After fermentation optimization, the titer of iturin and fengycin reached 31.1 mg/L and 175.3 mg/L in flask, and 123.5 mg/L and 1200.8 mg/L in bioreactor. Compared to the original strain, the iturin and fengycin titer in bioreactor increased by 22.8-fold and 15.9-fold in the final engineered strain, respectively. This study may pave the way for the commercial production of green antifungal lipopeptides, and is also favorable for understanding the regulatory and biosynthetic mechanism of iturin and fengycin.

show abstract

“…cDNA was produced by reverse transcription with 1 μg RNA, iScript Select cDNA Synthesis Kit and random oligonucleotide primers. qRT-PCR was performed with cDNA, SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and target-specific primers in Table S4 (Supplementary materials) in CF96 Real-Time System (Bio-Rad) as following: 1 cycle of 95 o C for 5 min, 40 cycles of 95 o C for 10 s, 45 o C for 20 s and 70 o C for 30 s. All expression data were normalized to the copy number of 16S rRNA in each sample [38].…”

Section: Qrt-pcrmentioning

confidence: 99%

“…The perR gene was amplified by PCR with primers perR -F (CGGGATCC ATGGCTGCACAT -GAATTAAA) and perR -R (CCCTCGAG GTGGTTCTCTTTTTTGGAAC), subcloned into the pET28a vector, then the recombinant plasmid was transformed into Escherichia coli BL21. The expression of PerR was induced by IPTG (2 mM), purified by Ni-NAT column (Qiagen, German), then used for intraperitoneal immunization of mice at 50 μg/mouse for 3 dosages after emulsification with Freund's adjuvant (Sigma, USA) [38]. After one week, the sera were collected for the following Western blot assay.…”

Section: Western Blot Analysismentioning

confidence: 99%

“…After being mixed with sample buffer, 10 μL of each protein sample was separated by 15% SDS-PAGE gel, transferred onto the polyvinylidene fluoride (PVDF) membrane (Millipore, USA), then incubated with the antisera at a dilution of 400 x for 1 h. After extensive wash, the membrane was incubated with goat anti-mouse IgG labeled with Horseradish Peroxidase (HRP) (Boster Biological Technology, China) at a dilution of 5,000 x for 30 min. After that, the membrane was washed, reacted with BeyoECL Star (Beyotime Biotechnology, China), then scanned by Monad QuickChemi 5100 (Zhuhai, China) [38].…”

Section: Western Blot Analysismentioning

confidence: 99%

See 1 more Smart Citation

Cellular redox state affects biofilm formation by a surfactin -dependent manner in Bacillus amyloliquefaciens?

Sun

Si²,

Zhao³

et al. 2023

Preprint

View full text Add to dashboard Cite

Surfactin is a signal to trigger biofilm formation against harsh environments. Generally, harsh environments can result in change of the cellular redox state to induce biofilm formation, but we know little about whether the cellular redox state influences biofilm formation via surfactin. Here, the reductant glucose could reduce surfactin and enhance biofilm formation by a surfactin-independent way. The oxidant H2O2 led to a decrease of surfactin accompanying with weakened biofilm formation. Spx and PerR were both necessary for surfactin production and biofilm formation. H2O2 improved surfactin production but inhibited biofilm formation by a surfactin-independent manner in Δspx, while it reduced surfactin production without obvious influence on biofilm formation in ΔperR. The ability against H2O2 stress was enhanced in Δspx, but weakened in ΔperR. Thereby, PerR was favorable for resisting oxidative stress, while Spx played a negative role in this action. Knockout and compensation of rex also supported that the cells could form biofilm by a surfactin-independent way. Collectively, surfactin is not a unique signal to trigger biofilm formation, and the cellular redox state can influence biofilm formation by a surfactin- dependent or independent way in B. amyloliquefaciens.

show abstract

Surfactin, a quorum sensing signal molecule, globally affects the carbon metabolism in Bacillus amyloliquefaciens

Cited by 13 publications

References 32 publications

Molecular genetics of surfactin and its effects on different sub-populations of Bacillus subtilis

Molecular genetics of surfactin and its effects on different sub-populations of Bacillus subtilis

Systemically engineering Bacillus amyloliquefaciens for increasing its antifungal activity and green antifungal lipopeptides production

Cellular redox state affects biofilm formation by a surfactin -dependent manner in Bacillus amyloliquefaciens?

Contact Info

Product

Resources

About