Synapse-Specific and Developmentally Regulated Targeting of AMPA Receptors by a Family of MAGUK Scaffolding Proteins

Abstract

In our paper we incorrectly listed CTCTATTGTTCGACTGTATAT as an alternative PSD-93 shRNA targeting sequence. The correct alternative sequence is CTGTGAGATTTGTAGCAGAAA.

Copy number variants analysis in a cohort of isolated and syndromic developmental delay/intellectual disability reveals novel genomic disorders, position effects and candidate disease genes

“…30 Synaptic transmission can also be modulated trans-synaptically, as in the case of the pre-synaptic adhesion molecule Neurexin-3 (encoded by the mouse orthologue of NRXN3), which can control the post-synaptic expression of the α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptors in the hippocampus. 31 All of these proteins are essential during the formation and maturation of synapses [Erbin, 32 Postsynaptic density (PSD)-93/ chapsyn-110, 33 Neurexin-3 34 ]. This evidence accrues on a robust body of evidence implicating synaptic function in ID and ASD pathophysiology.…”

Protracted and asynchronous accumulation of PSD95‐family MAGUKs during maturation of nascent dendritic spines

“…In fact, there is considerable functional overlap between the different PSD-MAGUKs. PSD93 and PSD95, for example, play similar roles supporting basal synaptic transmission in the hippocampus, but in largely non-overlapping populations of synapses (Elias et al, 2006). Additionally, expression of SAP102 is upregulated in the absence of PSD93 and PSD95, indicating a possible compensatory mechanism (Elias et al, 2006).…”

“…Because PSD93 is closely related to PSD95 (Brenman et al, 1996;Kim et al, 1996), and may be the principle MAGUK at a subset of hippocampal synapses (Elias et al, 2006), we reasoned that PSD93 might play the primary role in stabilizing new spines. We therefore measured the PSD93-GFP content as new spines matured on dendrites of hippocampal pyramidal neurons co-transfected with PSD93-GFP and DsRed-Express.…”

“…The low levels of both PSD93-GFP and PSD95-GFP at the earliest stages of new spine development suggested that there could be an additional PSD-MAGUK with a greater role at these earliest time points. Because the PSD-MAGUKs SAP102 and SAP97 also have demonstrated roles in regulating synapse stability (Nakagawa et al, 2004;Elias et al, 2006;Chen et al, 2011;Levy et al, 2015), and SAP102 has previously been implicated in early synapse development (Sans et al, 2000;Elias et al, 2008;Murata and Constantine-Paton, 2013), we examined whether SAP102 or SAP97 might arrive early to stabilize nascent spines. We therefore measured the content of GFP-tagged SAP97 or SAP102 as new spines matured on dendrites of hippocampal pyramidal neurons co-transfected with either SAP97-GFP or SAP102-GFP and DsRed-Express.…”

Identification of the Role of miR-142-5p in Alzheimer’s Disease by Comparative Bioinformatics and Cellular Analysis

“…The effect of miR-142-5p inhibition in Aβ 42 -treated SH-SY5Y cells was investigated with the evaluation of PSD-95 expression. A loss of synaptic integrity leads to cognitive impairment in the AD brain (Coleman and Yao, 2003; Gylys et al, 2004), and PSD-95 as a neuronal scaffolding protein (Niethammer et al, 1996) is known to influence synapse maturation and regulate synaptic plasticity in the neuronal network (Kennedy, 2000; Elias et al, 2006). Several studies demonstrated that the level of PSD-95 was considerably reduced in the AD brain (Gylys et al, 2004; Love et al, 2006).…”