T20-insensitive HIV-1 from naïve patients exhibits high viral fitness in a novel dual-color competition assay on primary cells

Neumann, Thomas; Hagmann, Isabel; Lohrengel, Sabine; Heil, Marintha; Derdeyn, Cynthia A.; Kräusslich, Hans‐Georg; Dittmar, Matthias T.

doi:10.1016/j.virol.2004.12.035

Cited by 40 publications

(52 citation statements)

References 43 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1b and 1c, the resulting viruses were able to replicate in MT-2 cells and PBMCs, as detected by both p24 and luciferase activity replication kinetics assays. Similar replication kinetics were observed between NL4-3 and NL4-3Ren, although a reduction in the level of replication of reporter-carrying virus was found, as has been previously reported in other systems [30,31,42,43]. …”

supporting

confidence: 88%

A new strategy based on recombinant viruses for assessing the replication capacity of HIV‐1

et al. 2008

View full text Add to dashboard Cite

ObjectiveIn heavily pretreated patients, resistance mutations arise in both protease (PR) and reverse transcriptase (RT) sequences; however, the relative impact of PR and RT mutations on viral fitness cannot be evaluated with the majority of systems. To address this issue we have developed a model based on recombinant viruses (RVs) that allows the analysis of the replication capacity (RC) of viral populations in which PR and RT are cloned either in combination or separately. MethodsRVs were generated for full-length polymerase (pol) gene, PR or RT sequences from nine naïve and 14 heavily pretreated HIV-infected patients in therapeutic failure. The relative RC was assessed by comparing luciferase activity between mutant RV and wild-type (wt) isolates. ResultsA strong decrease (460%) in the RC of the pol RV population was observed in the 14 heavily pretreated patients as compared with the wt RVs. The analysis of PR and RT RVs from these patients showed that the decrease in RC was mainly attributable to PR sequences in three of these 14 patients and to RT sequences in seven of these patients. In the four remaining patients, PR and RT sequences independently reduced the RC of the RVs to similar extents. ConclusionsDifferent patterns of mutations in either PR or RT have a strong impact on RC in highly experienced HIV-infected patients.Keywords: drug resistance, protease, Renilla luciferase, replicative fitness, reverse transcriptase IntroductionTreatment of HIV-1-infected patients with highly active antiretroviral therapy (HAART) has significantly reduced the rate of morbidity and mortality associated with HIV-1 infections [1]. Although the main goal of HAART in the management of HIV disease is the suppression of viral replication, defined as the achievement and maintenance of undetectable viraemia in plasma [2,3], failure to achieve complete viral suppression is common [4]. However, despite virological failure, a number of patients have exhibited 'discordant CD4 cell/viral load' responses, defined as stable or increasing CD4 cell counts while viraemia persists [5][6][7][8][9]. Different immune-based mechanisms have been proposed to explain this paradoxical phenomenon: impaired viral replication in thymic tissue [10], decreased cell death by activation-induced apoptosis [11], or regeneration of HIV-specific immune responses [12,13]. However, several studies have suggested a direct decrease in replication capacity (RC) as a result of resistance mutations and a consequent reduction in cytopathic effect as the cause of the sustained immunological benefit observed in the presence of a high viral load.Viral fitness can be defined as the ability of a virus to replicate in a given environment in comparison with a reference strain. This is a complex parameter that depends on multiple viral and host factors. Alterations in any of the viral genes involved in cell entry, reverse transcription, integration, gene expression, assembly, egress or *Present address: Department of Infectious Diseases, Hospital Clinic IDIBAPS, Barcelo...

show abstract

supporting

confidence: 88%

A new strategy based on recombinant viruses for assessing the replication capacity of HIV‐1

et al. 2008

View full text Add to dashboard Cite

show abstract

“…We previously reported that Env encoded in cis from a provirus mediated fusion more efficiently than did Env from pseudotyped virions (37). We therefore amplified and subcloned these 37 Envs into the TN6-GFP molecular clone (36). All Env inserts were confirmed by sequencing.…”

Section: Resultsmentioning

confidence: 99%

“…To facilitate cloning of the primary envelopes into the proviral DNA, we selected the TN6-green fluorescent protein (GFP) proviral DNA expression vector, an NL4-3-based construct modified to contain a BstEII restriction site 15 nucleotides (nt) after the signal peptide of the NL4-3 env and a NcoI site at the end of the envelope (36). The primary wild-type (WT) envelopes were amplified with the sense primer C6323ϩ (TTGTGGGTCACCG TCTATTATGGGG) and the antisense primer ASenvNcoI (CTGCAT CCATGGTTTATTGTAAAGCTGCTTC).…”

Section: Methodsmentioning

confidence: 99%

Enhanced Fusion and Virion Incorporation for HIV-1 Subtype C Envelope Glycoproteins with Compact V1/V2 Domains

Cavrois

Neidleman

Santiago

et al. 2014

J Virol

Self Cite

View full text Add to dashboard Cite

In infected people, the HIV-1 envelope glycoprotein (Env) constantly evolves to escape the immune response while retaining the essential elements needed to mediate viral entry into target cells. The extensive genetic variation of Env is particularly striking in the V1/V2 hypervariable domains. In this study, we investigated the trade-off, in terms of fusion efficiency, for encoding V1/V2 domains of different lengths. We found that natural variations in V1/V2 length exert a profound impact on HIV-1 entry. Variants encoding compact V1/V2 domains mediated fusion with higher efficiencies than related Envs encoding longer V1/V2 domains. By exchanging the V1/V2 domains between Envs of the same infected person or between two persons linked by a transmission event, we further demonstrated that V1/V2 domains critically influence both Env incorporation into viral particles and fusion to primary CD4 T cells and monocyte-derived dendritic cells. Shortening the V1/V2 domains consistently increased Env incorporation and fusion, whereas lengthening the V1/V2 domains decreased Env incorporation and fusion. Given that in a new host transmitted founder viruses are distinguished by compact Envs with fewer glycosylation sites, our study points to fusion and possibly Env incorporation into virions as limiting steps for transmission of HIV-1 to a new host and suggests that the length and/or the N-glycosylation profile of the V1/V2 domain influences these early steps in the HIV life cycle.

show abstract

“…The reduced susceptibility observed in some isolates from enfuvirtide-naive patients is not thought to be clinically significant, since no reduction in the virologic response to enfuvirtide in patients whose isolates demonstrate this property could be demonstrated (121). Interestingly, envelope sequences from enfuvirtide-naive patients that had reduced susceptibility to enfuvirtide but that did not have known resistance mutations had preserved fitness, using a growth competition assay in PBMCs, in contrast to resistant mutants that develop during treatment failure (125).…”

Section: Mutations Conferring Resistance To Entry Inhibitorsmentioning

confidence: 99%

“…Zhang and coworkers designed a recombinant-virus single-cycle assay in which the GFP gene replaces env in the infectious HIV-1 molecular clone pNL4-3; test and reference strains were then compared in parallel infections (184). The use of red fluorescent proteins (DsRed2) and EGFPs as markers in a multiple-cycle recombinant-virus growth competition assay in primary human PBMCs has also been described and was used to characterize the relative fitness of mutants that are resistant to the fusion inhibitor enfuvirtide (125).…”

Section: Cell Culture Assaysmentioning

confidence: 99%

Clinical Significance of Human Immunodeficiency Virus Type 1 Replication Fitness

Dykes

Demeter

2007

Clin Microbiol Rev

View full text Add to dashboard Cite

SUMMARY The relative fitness of a variant, according to population genetics theory, is that variant's relative contribution to successive generations. Most drug-resistant human immunodeficiency virus type 1 (HIV-1) variants have reduced replication fitness, but at least some of these deficits can be compensated for by the accumulation of second-site mutations. HIV-1 replication fitness also appears to influence the likelihood of a drug-resistant mutant emerging during treatment failure and is postulated to influence clinical outcomes. A variety of assays are available to measure HIV-1 replication fitness in cell culture; however, there is no agreement regarding which assays best correlate with clinical outcomes. A major limitation is that there is no high-throughput assay that incorporates an internal reference strain as a control and utilizes intact virus isolates. Some retrospective studies have demonstrated statistically significant correlations between HIV-1 replication fitness and clinical outcomes in some patient populations. However, different studies disagree as to which clinical outcomes are most closely associated with fitness. This may be in part due to assay design, sample size limitations, and differences in patient populations. In addition, the strength of the correlations between fitness and clinical outcomes is modest, suggesting that, at present, it would be difficult to utilize these assays for clinical management.

show abstract

T20-insensitive HIV-1 from naïve patients exhibits high viral fitness in a novel dual-color competition assay on primary cells

Cited by 40 publications

References 43 publications

A new strategy based on recombinant viruses for assessing the replication capacity of HIV‐1

A new strategy based on recombinant viruses for assessing the replication capacity of HIV‐1

Enhanced Fusion and Virion Incorporation for HIV-1 Subtype C Envelope Glycoproteins with Compact V1/V2 Domains

Clinical Significance of Human Immunodeficiency Virus Type 1 Replication Fitness

Contact Info

Product

Resources

About