TAK1 inhibition subverts the osteoclastogenic action of TRAIL while potentiating its antimyeloma effects

Tenshin, Hirofumi; Teramachi, Jumpei; Oda, Asuka; Amachi, Ryota; Hiasa, Masahiro; Bat-Erdene, Ariunzaya; Watanabe, Keiichiro; Iwasa, Masami; Harada, Takeshi; Fujii, Soichiro; Kagawa, Keiichiro; Sogabe, Kimiko; Nakamura, Shingen; Miki, Hirokazu; Kurahashi, Kiyoe; Yoshida, Sumiko; Aihara, Ken-ichi; Endo, Itsuro; Tanaka, Eiji; Matsumoto, Toshio; Abe, Masahiro

doi:10.1182/bloodadvances.2017008813

Cited by 10 publications

(10 citation statements)

References 47 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Consistent with previous observations, 20 , 34 RANKL induced the phosphorylation of TAK1 in parallel with the degradation of IκBα and phosphorylation of p38MAPK and ERK ( Figure 4A ), and nuclear localization of the NF-κB subunit p65 ( Figure 4B ) in RAW264.7 preosteoclastic cells. However, treatment with LLZ abolished all of these RANKL-mediated changes, indicating critical involvement of TAK1 in RANKL-induced activation of the NF-κB and MAPK pathways.…”

Section: Resultssupporting

confidence: 92%

“…Small interfering RNA (siRNA) transduction was performed as described previously. 5 , 20 Human and mouse TAK1 siRNA were purchased from Santa Cruz. Human TAK1 siRNA was transfected into MM cells using a Human Nucleofector Kit (Lonza, Basel, Switzerland).…”

Section: Methodsmentioning

confidence: 99%

“…RNA isolation and quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) were performed as described previously. 20 The following primer sequences were used: human RANKL F: TCGTTGGATCACAGCACATCA and R: TATGGGAACCAGATGGGATGTC, human IL-6 F: TCTGAGGCTCATTCTGCCCTCGAGC and R: AACTGGACCGAAGGCGCTTGTGGA, human GAPDH , used as an endogenous control to normalize each sample, F: TGTCTTCACCACCATGGAGAAGG and R: GTGGATGCAGGGATGATGTTCTG…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

TAK1 is a pivotal therapeutic target for tumor progression and bone destruction in myeloma

et al. 2020

View full text Add to dashboard Cite

Along with the tumor progression, the bone marrow microenvironment is skewed in multiple myeloma (MM), which underlies the unique pathophysiology of MM and confers aggressiveness and drug resistance in MM cells. TGF-β-activated kinase-1 (TAK1) mediates a wide range of intracellular signaling pathways. We demonstrate here that TAK1 is constitutively overexpressed and phosphorylated in MM cells, and that TAK1 inhibition suppresses the activation of NF-κB, p38MAPK, ERK and STAT3 to decrease the expression of critical mediators for MM growth and survival, including PIM2, MYC, Mcl-1, IRF4, and Sp1, along with a substantial reduction in the angiogenic factor VEGF in MM cells. Intriguingly, TAK1 phosphorylation was also induced along with upregulation of vascular cell adhesion molecule-1 (VCAM-1) in bone marrow stromal cells (BMSCs) in cocultures with MM cells, which facilitated MM cell-BMSC adhesion while inducing IL-6 production and receptor activator of nuclear factor κ -Β ligand (RANKL) expression by BMSCs. TAK1 inhibition effectively impaired MM cell adhesion to BMSCs to disrupt the support of MM cell growth and survival by BMSCs. Furthermore, TAK1 inhibition suppressed osteoclastogenesis enhanced by RANKL in cocultures of bone marrow cells with MM cells, and restored osteoblastic differentiation 5 suppressed by MM cells or inhibitory factors for osteoblastogenesis overproduced in MM.Finally, treatment with the TAK1 inhibitor LLZ1640-2 markedly suppressed MM tumor growth and prevented bone destruction and loss in mouse MM models. Therefore, TAK1 inhibition may be a promising therapeutic option targeting not only MM cells but also the skewed bone marrow microenvironment in MM. Methods

show abstract

Section: Resultssupporting

confidence: 92%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

TAK1 is a pivotal therapeutic target for tumor progression and bone destruction in myeloma

et al. 2020

View full text Add to dashboard Cite

show abstract

“…Of note, TAK1 phosphorylation is also induced in BMSCs in cocultures with MM cells, which facilitates MM cell adhesion to BMSCs via interaction between VLA-4 and VCAM-1, thereby inducing IL-6 production and RANKL expression by BMSCs [100]. In OC precursors, RNAKL upregulates cellular FLICE inhibitory protein (c-FLIP), which blocks death signaling from stimulation of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) [146]. Therefore, TRAIL does not induce apoptosis in OC-lineage cells but induces phosphorylation of TAK1 through a death receptor-mediated formation of complex II and activates NF-κB signaling pathway, resulting in enhancement of OC formation, survival, and activation.…”

Section: Targeting Tak1mentioning

confidence: 99%

Myeloma–Bone Interaction: A Vicious Cycle via TAK1–PIM2 Signaling

Harada

Hiasa

Teramachi

et al. 2021

Cancers

Self Cite

View full text Add to dashboard Cite

Multiple myeloma (MM) has a propensity to develop preferentially in bone and form bone-destructive lesions. MM cells enhance osteoclastogenesis and bone resorption through activation of the RANKL–NF-κB signaling pathway while suppressing bone formation by inhibiting osteoblastogenesis from bone marrow stromal cells (BMSCs) by factors elaborated in the bone marrow and bone in MM, including the soluble Wnt inhibitors DKK-1 and sclerostin, activin A, and TGF-β, resulting in systemic bone destruction with loss of bone. Osteocytes have been drawn attention as multifunctional regulators in bone metabolism. MM cells induce apoptosis in osteocytes to trigger the production of factors, including RANKL, sclerostin, and DKK-1, to further exacerbate bone destruction. Bone lesions developed in MM, in turn, provide microenvironments suited for MM cell growth/survival, including niches to foster MM cells and their precursors. Thus, MM cells alter the microenvironments through bone destruction in the bone where they reside, which in turn potentiates tumor growth and survival, thereby generating a vicious loop between tumor progression and bone destruction. The serine/threonine kinases PIM2 and TAK1, an upstream mediator of PIM2, are overexpressed in bone marrow stromal cells and osteoclasts as well in MM cells in bone lesions. Upregulation of the TAK1–PIM2 pathway plays a critical role in tumor expansion and bone destruction, posing the TAK1–PIM2 pathway as a pivotal therapeutic target in MM.

show abstract

“…OCs were produced from murine preosteoclastic cell line RAW264.7 cells or mouse bone marrow cells as previously explained [40,41]. Whole bone marrow cells were harvested from the femur of C57BL/6J mice (SLC, Tokyo, Japan), and nonadherent cells were collected and cultured with M-CSF (10 ng/mL) for 3 days to generate primary BMMs.…”

Section: Oc Formationmentioning

confidence: 99%

The Roles of ROS Generation in RANKL-Induced Osteoclastogenesis: Suppressive Effects of Febuxostat

Ashtar

Tenshin

Teramachi

et al. 2020

Cancers

Self Cite

View full text Add to dashboard Cite

Receptor activator of NF-κB ligand (RANKL), a critical mediator of osteoclastogenesis, is upregulated in multiple myeloma (MM). The xanthine oxidase inhibitor febuxostat, clinically used for prevention of tumor lysis syndrome, has been demonstrated to effectively inhibit not only the generation of uric acid but also the formation of reactive oxygen species (ROS). ROS has been demonstrated to mediate RANKL-mediated osteoclastogenesis. In the present study, we therefore explored the role of cancer-treatment-induced ROS in RANKL-mediated osteoclastogenesis and the suppressive effects of febuxostat on ROS generation and osteoclastogenesis. RANKL dose-dependently induced ROS production in RAW264.7 preosteoclastic cells; however, febuxostat inhibited the RANKL-induced ROS production and osteoclast (OC) formation. Interestingly, doxorubicin (Dox) further enhanced RANKL-induced osteoclastogenesis through upregulation of ROS production, which was mostly abolished by addition of febuxostat. Febuxostat also inhibited osteoclastogenesis enhanced in cocultures of bone marrow cells with MM cells. Importantly, febuxostat rather suppressed MM cell viability and did not compromise Dox's anti-MM activity. In addition, febuxostat was able to alleviate pathological osteoclastic activity and bone loss in ovariectomized mice. Collectively, these results suggest that excessive ROS production by aberrant RANKL overexpression and/or anticancer Cancers 2020, 12, 929 2 of 16 treatment disadvantageously impacts bone, and that febuxostat can prevent the ROS-mediated osteoclastic bone damage.

show abstract

TAK1 inhibition subverts the osteoclastogenic action of TRAIL while potentiating its antimyeloma effects

Cited by 10 publications

References 47 publications

TAK1 is a pivotal therapeutic target for tumor progression and bone destruction in myeloma

TAK1 is a pivotal therapeutic target for tumor progression and bone destruction in myeloma

Myeloma–Bone Interaction: A Vicious Cycle via TAK1–PIM2 Signaling

The Roles of ROS Generation in RANKL-Induced Osteoclastogenesis: Suppressive Effects of Febuxostat

Contact Info

Product

Resources

About