Targeted Expression of Major Histocompatibility Complex (MHC) Class II Molecules Demonstrates that Dendritic Cells Can Induce Negative but Not Positive Selection of Thymocytes In Vivo

Abstract

It is well established that lymphoid dendritic cells (DC) play an important role in the immune system. Beside their role as potent inducers of primary T cell responses, DC seem to play a crucial part as major histocompatibility complex (MHC) class II+ “interdigitating cells” in the thymus during thymocyte development. Thymic DC have been implicated in tolerance induction and also by some authors in inducing major histocompatibility complex restriction of thymocytes. Most of our knowledge about thymic DC was obtained using highly invasive and manipulatory experimental protocols such as thymus reaggregation cultures, suspension cultures, thymus grafting, and bone marrow reconstitution experiments. The DC used in those studies had to go through extensive isolation procedures or were cultured with recombinant growth factors. Since the functions of DC after these in vitro manipulations have been reported to be not identical to those of DC in vivo, we intended to establish a system that would allow us to investigate DC function avoiding artificial interferences due to handling. Here we present a transgenic mouse model in which we targeted gene expression specifically to DC. Using the CD11c promoter we expressed MHC class II I-E molecules specifically on DC of all tissues, but not on other cell types. We report that I-E expression on thymic DC is sufficient to negatively select I-E reactive CD4+ T cells, and to a less complete extent, CD8+ T cells. In contrast, if only DC expressed I-E in a class II–deficient background, positive selection of CD4+ T cells could not be observed. Thus negative, but not positive, selection events can be induced by DC in vivo.

‘Survival gene’ Bcl-xl potentiates DNA-raised antitumor immunity

“…However, genes under control of the DC-specific CD11c promoter have been demonstrated and generally accepted to specifically express in DCs in vivo. 16,26 Our results indirectly indicates that DCs can be transfected by CD11c-Bcl-xl DNA (unpublished observations), and subsequently prolong T-cell stimulation in vivo ( Figure 2). Enhanced immunity by increased DC survival was reported in 'survival gene' Bcl-2 transgenic mice.…”

“…Hsp70 was generated by cloning hsp70 including stop codon into pcDNA 3.1(+) vector at the unique sites of NheI and NotI using primers: 5' CTAGCTAGCATGGCCAAA GCCGCGGCAGTC and P2. Human antiapoptotic gene Bcl-xl 54 or EGFP was cloned into the CD11c-pDOI-5 vector 26 at the unique site of EcoR I using primers: Bcl-xl: 5 0 CGGAATTCACCATGTCTCAGAGCAACCGG and 5 0 CGGAATTCTCATTTCCGACTGAAGAG; EGFP: 5 0 CGG AATTCACCATGGTGAGCAAGGGCGAG and 5 0 CGGA ATTCTTACTTGTACAGCTCGTCCAT. All plasmids were confirmed by sequencing.…”

“…25 This raises the concern that delivery of Bcl-xl DNA in vivo into somatic cells, B cells and stem cells may induce tumorgensis. Expressing Bclxl under control of the DC-specific (CD11c) promoter 26 would specifically prolong the lifespan of DCs without interfering with antigen-bearing somatic cells dying (an antigen resource for DCs), but at the same time may minimize the incidences of Bcl-xl-induced tumorgensis (due to the related short life, nonproliferation and terminal differentiation of DCs in vivo).…”

Vaccination with filamentous bacteriophages targeting DEC‐205 induces DC maturation and potent anti‐tumor T‐cell responses in the absence of adjuvants

“…Indeed we found that DCs showed an enhanced receptormediated binding and internalization of phage particles expressing the anti-DEC-205 scFv. However, DCs may play a dual role either inducing adaptive immune response or maintaining tolerance [13,22,23]. In particular, targeting of DEC-205 is usually not associated with the induction of antigen-specific T cells and thus in previous works additional DC activation/ maturation compounds needed to be given as well [6][7][8][9][10][11][12].…”

Switching from a restricted to an effective CD4 T cell response by activating CD8+ murine dendritic cells with a Toll-like receptor 9 ligand

“…DC are now implicated in the regulation of the responses they initiate and in the maintenance of tolerance to self components [1,2]. DC are involved in both central tolerance in the thymus [3,4] and in peripheral tolerance of self-reactive T cells that have escaped intra-thymic deletion [2,[5][6][7]. The activation or 'maturation' state of the DC is believed to determine the balance between tolerance and immunity.…”