Targeting Cancer Resistance via Multifunctional Gold Nanoparticles

Abstract

Resistance to chemotherapy is a major problem facing current cancer therapy, which is continuously aiming at the development of new compounds that are capable of tackling tumors that developed resistance toward common chemotherapeutic agents, such as doxorubicin (DOX). Alongside the development of new generations of compounds, nanotechnology-based delivery strategies can significantly improve the in vivo drug stability and target specificity for overcoming drug resistance. In this study, multifunctional gold nanoparticles (AuNP) have been used as a nanoplatform for the targeted delivery of an original anticancer agent, a Zn(II) coordination compound [Zn(DION)2]Cl2 (ZnD), toward better efficacy against DOX-resistant colorectal carcinoma cells (HCT116 DR). Selective delivery of the ZnD nanosystem to cancer cells was achieved by active targeting via cetuximab, NanoZnD, which significantly inhibited cell proliferation and triggered the death of resistant tumor cells, thus improving efficacy. In vivo studies in a colorectal DOX-resistant model corroborated the capability of NanoZnD for the selective targeting of cancer cells, leading to a reduction of tumor growth without systemic toxicity. This approach highlights the potential of gold nanoformulations for the targeting of drug-resistant cancer cells.

Chloroquine increases the anti‑cancer activity of epirubicin in A549 lung cancer cells

“…Chemotherapy serves an important role in the treatment of lung cancer; however, even the most effective chemotherapy has only a 30-50% response rate (20). Drug resistance of tumor cells has become an increasingly prominent setback during chemotherapy, as it severely limits Forward Reverse Amplification product length, bp LC3B ATTTCATCCCGAACGTCTCCT GCGCTTACAGCTCAATGCTAA 161 Beclin-1 GAGATACCGACTTGTTCCTTACG CTCGCCTTTCTCAACCTCTTCTT 184 GAPDH GGACCTGACCTGCCGTCTAG GTAGCCCAGGATGCCCTTGA 100 LC3B, microtubule associated protein 1 light chain 3 β. the efficacy of chemotherapeutic drugs, which in turn has meant that drug resistance has been the focus of an increasing amount of studies (21). Multiple studies have reported that autophagy may be involved in chemotherapeutic resistance developed in lung cancer (20,(22)(23)(24)(25), and that inhibiting autophagy may reduce resistance and enhance the efficacy of chemotherapeutics.…”

Gene Therapy in Cancer Treatment: Why Go Nano?

“…In the last years, several different applications of AuNPs as carriers in cancer therapy have been described [17,[160][161][162]. Indeed, AuNPs functionalized with novel drugs/compounds have been described to increase drug efficacy and tumor reduction [49,160,163,164]. Recently, Coelho et al developed a drug delivery nanosystem based on pegylated AuNPs loaded with doxorubicin and varlitinib, an anthracycline and a tyrosine kinase inhibitor respectively, for a combined approach against pancreatic cancer cells [165].…”

Gold Nanoparticles for Vectorization of Nucleic Acids for Cancer Therapeutics

“…Nevertheless, perhaps the most used metallic nanoparticles for gene therapy have been based on gold. In fact, AuNPs have been described as specific and efficient carriers, used in target-specific delivery of RNAi (e.g., siRNA, miRNA, shRNA), alone or in combination with drugs or antibodies, for example [91,92]. In fact, AuNPs have been used as theranostic systems in cancer, due to their biocompatibility and unique physico-chemical properties, including their optical behavior derived from the localized surface plasmon resonance (SPR).…”