Targeting homeostatic mechanisms of endoplasmic reticulum stress to increase susceptibility of cancer cells to fenretinide-induced apoptosis: the role of stress proteins ERdj5 and ERp57

Abstract

Endoplasmic reticulum (ER) malfunction, leading to ER stress, can be a consequence of genome instability and hypoxic tissue environments. Cancer cells survive by acquiring or enhancing survival mechanisms to counter the effects of ER stress and these homeostatic responses may be new therapeutic targets. Understanding the links between ER stress and apoptosis may be approached using drugs specifically to target ER stress responses in cancer cells. The retinoid analogue fenretinide [N-(4-hydroxyphenyl) retinamide] is a new cancer preventive and chemotherapeutic drug, that induces apoptosis of some cancer cell types via oxidative stress, accompanied by induction of an ER stress-related transcription factor, GADD153. The aim of this study was to test the hypothesis that fenretinide induces ER stress in neuroectodermal tumour cells, and to elucidate the role of ER stress responses in fenretinide-induced apoptosis. The ER stress genes ERdj5, ERp57, GRP78, calreticulin and calnexin were induced in neuroectodermal tumour cells by fenretinide. In contrast to the apoptosis-inducing chemotherapeutic drugs vincristine and temozolomide, fenretinide induced the phosphorylation of eIF2α, expression of ATF4 and splicing of XBP-1 mRNA, events that define ER stress. In these respects, fenretinide displayed properties similar to the ER stress inducer thapsigargin. ER stress responses were inhibited by antioxidant treatment. Knockdown of ERp57 or ERdj5 by RNA interference in these cells increased the apoptotic response to fenretinide. These data suggest that downregulating homeostatic ER stress responses may enhance apoptosis induced by oxidative stress-inducing drugs acting through the ER stress pathway. Therefore, ER-resident proteins such as ERdj5 and ERp57 may represent novel chemotherapeutic targets.

Oncogenic BRAF induces chronic ER stress condition resulting in increased basal autophagy and apoptotic resistance of cutaneous melanoma

“…45 In cutaneous metastatic melanoma, we have recently demonstrated the clinical potential of ER stress-induced apoptosis, with BRAF wt melanomas showing greater sensitivity, compared with tumours harbouring hyperactivating mutations in the BRAF protein kinase. 32,33 Moreover, we have also shown (and confirmed in the present study) that BRAF mutation is associated with increased levels of basal autophagy. 20 Interestingly, ER stress-induced apoptosis is reduced in melanoma cells harbouring oncogenic BRAF compared with the observed induction in BRAF wt melanoma cells, and in this context and in contrast to observations in BRAF mutant melanoma cells, we have also shown that autophagy inhibition significantly sensitizes BRAF wt melanoma cells to ER stressmediated apoptosis.…”

“…As shown in Figure 2a, BRAF V600E melanoma cell lines displayed approximately twofold greater expression of mRNA coding for ERdj5, ERp57, ATF4 and Xbp-I 33 compared with BRAF wt cells, indicating that a mild but consistent induction of ER stress is conferred by an activating mutation in the BRAF protein kinase. 28,32,33 To rule out the possibility that differences in ER stress induction were due to effects other than BRAF mutation, we expressed constitutively active BRAF V600E in the BRAF wt SKMel-110 melanoma cell line in order to compare melanoma cells with identical genetic background except for BRAF status. Cells stably expressing BRAF V600E or GFP were selected for more than 1 month in culture, in order to better represent in vivo tumour development and adaptation to BRAF activating mutation.…”

“…The human XBP-1 sequence was amplified by PCR using the primer pair AAACAGAGTAGCAGCTCAGACTGC and CCTTCTGGG TAGACCTCTGGGAG as previously described. 33 Quantitative RT-polymerase chain reaction. RNA was extracted by using Trizol reagent (Invitrogen) as indicated by the supplier.…”

“…Flow cytometry of propidium iodide-stained cells was used to estimate the level of cell death or apoptosis by measuring the percentage of cells in the sub-G1 fraction. 33 Confocal microscopy. Cells were grown on coverslips and fixed with 4% PFA in PBS followed by permeabilization with 0.1% Triton X-100 in PBS.…”

Downregulation of ER60 Protease Inhibits Cellular Proliferation by Inducing G1/S Arrest in Breast Cancer Cells In Vitro

“…It has been proposed that ER60 protease, an endoplasmic reticulum chaperone protein , is involved in endoplasmic reticulum stress response (Corazzari et al, 2007;Ni and Lee, 2007) and promotes tumor cell survival in hypoxic microenvironment brought about by poor vascularization (Koumenis, 2006).…”