1995
DOI: 10.1128/jvi.69.4.2611-2616.1995
|View full text |Cite|
|
Sign up to set email alerts
|

Tax mutation associated with tropical spastic paraparesis/human T-cell leukemia virus type I-associated myelopathy

Abstract: Tumaco, Colombia, is an area with elevated rates of tropical spastic paraparesis/human T-cell leukemia virus type I (HTLV-I)-associated myelopathy (TSP/HAM). We have identified a mutation in nucleotide 7959 of the tax gene of 14 Tumaco HTLV-I isolates (14 positive of 14 tested) that was present in 5 of 14 (35%) TSP/HAM patients from Japan and in 8 of 11 (72%) TSP/HAM patients from other geographic locations. In contrast, this mutation was found in only 2 of 21 (9.5%) HTLV-I-infected subjects outside of Tumaco … Show more

Help me understand this report

Search citation statements

Order By: Relevance

Paper Sections

Select...
2
1
1

Citation Types

1
6
0
1

Year Published

1995
1995
2024
2024

Publication Types

Select...
6
2

Relationship

0
8

Authors

Journals

citations
Cited by 37 publications
(8 citation statements)
references
References 42 publications
1
6
0
1
Order By: Relevance
“…As in the case of the TSPl isolate, the T Tax mutation is present at position 7959 in HTLV-IBo, (Fig. 2), which is consistent with the results of Renjifo et al (1995). However, TSPl and HTLV-IBoi isolates are both of cosmopolitan molecular genotypes, and recent results indicate that this nucleotide Tax mutation is not specifically associated with TSP/HAM but is linked to the cosmopolitan molecular genotype (Mahieux et al, 1995).…”
Section: Discussionsupporting
confidence: 86%
See 1 more Smart Citation
“…As in the case of the TSPl isolate, the T Tax mutation is present at position 7959 in HTLV-IBo, (Fig. 2), which is consistent with the results of Renjifo et al (1995). However, TSPl and HTLV-IBoi isolates are both of cosmopolitan molecular genotypes, and recent results indicate that this nucleotide Tax mutation is not specifically associated with TSP/HAM but is linked to the cosmopolitan molecular genotype (Mahieux et al, 1995).…”
Section: Discussionsupporting
confidence: 86%
“…No deletions or stop codons were observed within the env proteins gp46 and gp21 of HTLV-IBoi, which suggests that such mutations might be attributed to an artificial selection in culture. Renjifo et al (1995) have reported that a nucleotide mutation in Tax at position 7959 is associated with TSP/HAM outcome, independent of the geographical origin of the patient. As in the case of the TSPl isolate, the T Tax mutation is present at position 7959 in HTLV-IBo, (Fig.…”
Section: Discussionmentioning
confidence: 99%
“…The recent report by Renjifo et al (13) suggests ''that a mutation in tax nucleotide 7959 is associated with TSP/HAM [tropical spastic paraparesis/human T-cell leukemia virus type 1 (HTLV-1)-associated myelopathy] disease outcome independent of the geographical origin of the patient''. These data relate to the critical question which has been investigated since 1990 (3,6,14,(16)(17)(18)(19) of whether a hematological disorder (such as adult T-cell leukemia [ATL]) or a neurological process (such as TSP/HAM) associated with HTLV-1 is caused by a specific variant virus.We and others have demonstrated by a The primers used were Rmtax 1 (ACTAGAATTCGAACGGAAGGAGGCCGTTTTGC) and Rmtax2 (TTTGAGCGGCCGCACCTCTACCAGCTTT CCCCCCC), and the probe used for detection of the recombinant positive clones was probe tax (GGGGCCCTAATAATTCTACCCGAAGACT).…”
mentioning
confidence: 99%
“…However, the resounding conclusion was that no such disease-specific strains existed (Daenke et al, 1990; Kinoshita et al, 1991). Nonetheless, later work identified mutations in the region of the viral genome coding for tax associated with HAM/TSP morbidity (Kira et al, 1994; Renjifo et al, 1995). In one of these studies, mutant proviral tax sequences were frequently isolated from lesioned tissue sampled from the spines of patients with HAM/TSP (Kira et al, 1994).…”
Section: Nucleotide Sequence Variation Of Htlv-1 In Patients With Hammentioning
confidence: 99%