TcNPR3 from Theobroma cacao functions as a repressor of the pathogen defense response

Abstract

BackgroundArabidopsis thaliana (Arabidopsis) NON-EXPRESSOR OF PR1 (NPR1) is a transcription coactivator that plays a central role in regulating the transcriptional response to plant pathogens. Developing flowers of homozygous npr3 mutants are dramatically more resistant to infection by the pathogenic bacterium Pseudomonas syringae, suggesting a role of NPR3 as a repressor of NPR1-mediated defense response with a novel role in flower development.ResultsWe report here the characterization of a putative NPR3 gene from the tropical tree species Theobroma cacao (TcNPR3). Like in Arabidopsis, TcNPR3 was constitutively expressed across a wide range of tissue types and developmental stages but with some differences in relative levels compared to Arabidopsis. To test the function of TcNPR3, we performed transgenic complementation analysis by introducing a constitutively expressing putative TcNPR3 transgene into an Arabidopsis npr3 mutant. TcNPR3 expressing Arabidopsis plants were partially restored to the WT pathogen phenotype (immature flowers susceptible to bacterial infection). To test TcNPR3 function directly in cacao tissues, a synthetic microRNA targeting TcNPR3 mRNA was transiently expressed in cacao leaves using an Agrobacterium-infiltration method. TcNPR3 knock down leaf tissues were dramatically more resistance to infection with Phytophthora capsici in a leaf bioassay, showing smaller lesion sizes and reduced pathogen replication.ConclusionsWe conclude that TcNPR3 functions similar to the Arabidopsis NPR3 gene in the regulation of the cacao defense response. Since TcNPR3 did not show a perfect complementation of the Arabidopsis NPR3 mutation, the possibility remains that other functions of TcNPR3 remain to be found. This novel knowledge can contribute to the breeding of resistant cacao varieties against pathogens through molecular markers based approaches or biotechnological strategies.

Enhanced resistance in Theobroma cacao against oomycete and fungal pathogens by secretion of phosphatidylinositol‐3‐phosphate‐binding proteins

“…To test the efficacy of the proteins in cacao leaves, we developed an Agrobacterium-mediated transient gene expression system (agro-infiltration) capable of expressing substantial amounts of the proteins in a large percentage of leaf cells (Shi et al, 2013). The transgenes were driven by a very strong modified E12-Ω CaMV35S promoter (Mitsuhara et al, 1996).…”

“…For transient transformation of detached cacao leaves, A. tumefaciens cells containing each transgene were grown as described in Maximova et al (2003), induced with acetosyringone, and then vacuum-infiltrated into stage C leaves from cultivar Scavina6 as described in Shi et al (2013). The Petri dishes were sealed and incubated at 25°C for 2 days with light intensity of 145 m 2 /s and 14-h daylight.…”

The potato transcription factor StbZIP61 regulates dynamic biosynthesis of salicylic acid in defense against Phytophthora infestans infection

“…Accordingly, genetic analysis demonstrated that mutation of NPR1 results in decreased expression of defense response genes and increased susceptibility to pathogens (Cao et al ., ; Volko et al ., ; Dong, ; Yan and Dong, ), while NPR3 and NPR4 negatively regulate the pathogen resistance and a gain‐of‐function npr4 mutant repressed the immune responses constitutively in Arabidopsis (Zhang et al ., ; Ding et al ., ). Such a negative role of NPR3 was also reported with the TcNPR3 gene from cacao (Shi et al ., ).…”

TwoTheobroma cacaogenotypes with contrasting pathogen tolerance show aberrant transcriptional and ROS responses after salicylic acid treatment

“…Specific primers for P. tropicalis Actin (F: GACAACGGCTCCGGTATGTGCAAGG and R: GTCAGCACACCACGCTTGGACTG) and cacao Actin 7 (Tc01g010900) (F: AGGTGGAGATCATTGAAGGAGGGT and R: ACCAGCGGTCATCACAAGTCACAA) genes were used as pathogen and host targets. qPCR was performed using an ABI 7300 (Applied Biosystems, Foster City, CA, USA) as previously described ( Shi et al , 2013 ). Differences between genotypes and treatments were identified using Fisher’s partial least-squares difference analysis.…”

“…Recent evidence suggests that T. cacao also uses the SA-dependent pathway during defence responses ( Borrone et al , 2004 ; Bailey et al ., 2005 a , b ; Maximova et al , 2006 ; Gesteira et al , 2007 ), and PR genes are up-regulated in leaves after treatment with the SA analogue BTH ( Verica et al , 2004 ). Moreover, genes encoding cacao homologues of NPR1 (Tc09_g007660) and NPR3 (Tc06_g011480) can partially restore the Arabidopsis npr1 and npr3 mutant phenotypes, demonstrating the highly conserved nature of this signalling pathway ( Shi et al ., 2010 , 2013 ). In contrast, the transcriptional responses of Theobroma cacao cultivar ‘Comum’ to infection by WBD did not include significant changes in the transcription of genes in the SA pathway although there was activation of a variety of other genes implicated in defence responses and repression of photosynthesis ( Teixeira et al , 2014 ), implying that the SA pathway may not be the predominant mechanism of response to this particular pathogen or in this cultivar.…”