Telomere correlations during early life in a long-lived seabird

Abstract

Telomere dynamics in blood cells have been linked to aging in a variety of organisms. However, whether blood telomeres are correlated with telomeres in other parts of the body is not well known, especially during early life when telomere loss is expected to be most rapid. We investigated this question in Franklin's gulls (Leucophaeus pipixcan) by measuring telomere lengths in blood and several other tissues including: heart, liver, and skeletal muscle at the end of embryonic (n=31) and post-natal development (n=20). In late-stage embryos, blood telomeres were significantly positively correlated with heart and skeletal muscle, but not liver telomeres. However, at the end of post-natal development, there were no significant correlations among blood telomeres and telomeres in any other tissues. In late-stage embryos, heart telomeres were significantly longer than blood, liver, and skeletal muscle telomeres, but at the end of post-natal development telomere lengths did not significantly differ among tissues. These results suggest that blood telomere length is not necessarily indicative of other tissues at all stages of development and highlights the importance of understanding any functional consequences of tissue specific telomere dynamics in early life.

Early‐breeding females experience greater telomere loss

“…Telomere primers were as follows: forward tel1b (5’‐ CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT‐3′) and reverse tel2b (5’‐GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT‐3′). Reaction volumes were 25 µl and contained 6 uL DNA (20 ng per well) (Schmidt et al, ), 12.5 µl perfecta SYBR green supermix Low ROX (Stratagene), and 200 nM/200 nM forward GAPDH/reverse GAPDH or 200 nM/200 nM forward tel1b/reverse tel2b .…”

“…A standard curve (40, 20, 10, 5 and 2.5 ng) from a single reference sample was run in triplicate on every plate to control for interplate variation (Schmidt et al, ). These values were chosen because they consistently produce reactions with optimal efficiencies (Bauer et al, ; Schmidt et al, ). The curve was made by mixing red blood cell samples from six one‐year‐old male dark‐eyed juncos and extracting DNA from the pooled sample four times.…”

“…GAPDH primer sequences were as follows: forward GAPDH (5'-AACCAGCCAAGTACGATGACAT-3′) and reverse GAPDH (5′-CCATCAGCAGCAGCCTTCA-3′). Telomere primers were as follows: forward tel1b (5'-CGGTTTGTTTGG GTTTGGGTTTGGGTTTGGGTTTGGGTT-3′) and reverse tel2b A standard curve (40, 20, 10, 5 and 2.5 ng) from a single reference sample was run in triplicate on every plate to control for interplate variation (Schmidt et al, 2016). These values were chosen because they consistently produce reactions with optimal efficiencies (Bauer et al, 2018(Bauer et al, , 2016Schmidt et al, 2016).…”

Increasing the accuracy and precision of relative telomere length estimates by RT qPCR

“…Estimates of rTL varied according to storage media and DNA extraction methods that are commonly used in ecology and evolution. rTL estimates are influenced by various preanalytical factors, such as source tissue (Reichert, Criscuolo, Verinaud, Zahn, & Massemin, ; Schmidt et al., ), the time period before analysis, DNA purity, integrity and storage (Denham et al., ; Dlouha et al., ; Zanet et al., ). Our study adds to a body of literature showing that DNA extraction also influences rTL estimates.…”

“…Note, however, that it has recently become clear that the coefficient of variation is not an appropriate reliability measure for qPCR or TRF, and calculating repeatability has been suggested as an alternative (Eisenberg, ; Verhulst et al., ). TRF and qPCR reliability has mostly been estimated through repeated measurements of isolated DNA samples (Aviv et al., ; Martin‐Ruiz et al., ), but reliability may also depend on preanalytical steps such as sample collection (timing and sample type) and storage (freezing, preservatives and duration; Koppelstaetter et al., ; Zanet et al., ; Dlouha, Maluskova, Kralova Lesna, Lanska, & Hubacek, ; Tolios, Teupser, & Holdt, ; Schmidt et al., ), and DNA extraction and storage (Boardman, Skinner, & Litzelman, ; Cunningham et al., ; Denham, Marques, & Charchar, ; Hofmann et al., ; Raschenberger et al., ; Seeker et al., ; Tolios et al., ). How blood sample storage media commonly used in ecological studies impact measures of telomere length is currently unknown but given that qPCR results are susceptible to DNA damage, differences are likely to occur between drastically different storage methods (e.g., between lysis buffers that dissolve the DNA, or those that leave the DNA contained within the cells such as ethanol or snap freezing; Nussey et al., ).…”