Temporal stability analysis of the microbiota in human feces by denaturing gradient gel electrophoresis using universal and group-specific 16S rRNA gene primers

Abstract

According to the current insights, the predominant bacterial community in human feces is considered to be stable and unique for each individual over a prolonged period of time. In this study, the temporal stability of both the predominant population and a number of specific subpopulations of the fecal microbiota of four healthy volunteers was monitored for 6-12 weeks. For this purpose, a combination of different universal (V(3) and V(6)-V(8)) and genus- or group-specific (targeting the Bacteroides fragilis subgroup, the genera Bifidobacterium and Enterococcus and the Lactobacillus group, which also comprises the genera Leuconostoc, Pediococcus and Weisella) 16S rRNA gene primers was used. Denaturing gradient gel electrophoresis (DGGE) was used to analyze the 16S rRNA gene amplicons generating population fingerprints which were compared visually and by numerical analysis. DGGE profiles generated by universal primers were relatively stable over a three-month period and these profiles were grouped by numerical analysis in subject-specific clusters. In contrast, the genus- and group-specific primers yielded profiles with varying degrees of temporal stability. The Bacteroides fragilis subgroup and Bifidobacterium populations remained relatively stable which was also reflected by subject-specific profile clustering. The Lactobacillus group showed considerable variation even within a two-week period and resulted in complete loss of subject-grouping. The Enterococcus population was detectable by DGGE analysis in only half of the samples. In conclusion, numerical analysis of 16S rRNA gene-DGGE profiles clearly indicates that the predominant fecal microbiota is host-specific and relatively stable over a prolonged time period. However, some subpopulations tended to show temporal variations (e.g., the Lactobacillus group) whereas other autochthonous groups (e.g., the bifidobacteria and the Bacteroides fragilis subgroup) did not undergo major population shifts in time.

A Molecular Analysis of Fecal and Mucosal Bacterial Communities in Irritable Bowel Syndrome

“…The mean percentage similarity between individuals in both cohorts was low, but in agreement with previously published studies in the gut [6,13,14,29,35]. The reason for this low similarity was due to the primers we used, which covered the V1-V3 regions of the 16S rRNA gene and encompassed the three most variable regions of the gene [34], hence they were expected to give the greatest variability from DGGE.…”

Desulfovibrionales-related bacteria in a paper mill environment as detected with molecular techniques and culture

“…This result suggests that V 3 primers are less discriminatory as universal primers for DGGE than V 6 -V 8 primers. This was earlier evidenced by some difficulties of the V 6 -V 8 primers to generate an amplicon from some type strains of Bacteroides species [24]. The same phenomenon was detected in this study, since the type strains of Desulfovibrio desulfuricans and Desulfomicrobium escambiense did not amplify with V 6 -V 8 primers.…”

“…However, V 3 primers clearly generated more amplicons separable in the DGGE than V 6 -V 8 primers. Vanhoutte et al [24] found that the similarity values of amplicons generated with V 6 -V 8 primers were usually higher than those of the amplicons generated with V 3 primers. This result suggests that V 3 primers are less discriminatory as universal primers for DGGE than V 6 -V 8 primers.…”

Diversity and temporal stability of fecal bacterial populations in elderly subjects consuming galacto-oligosaccharide containing probiotic yoghurt

“…Bifidobacteria were PCR-amplified with primers Bif164-f (GGG TGGTAATGCCGGATG) and Bif662-GC-r (CGCCC-GCCGCGCGCGGCGGGCGGGGCGGGGGCACGG-GGGGCCACCGTTACACCGGGAA) to evaluate the diversity and temporal stability of bifidobacteria according to Satokari, Vaughan, Akkermans, Saarela, and de Vos (2001a). The Lactobacillus-group, which comprises the genera Lactobacillus, Leuconostoc, Pediococcus, and Weissella, was amplified as described by Vanhoutte, Huys, De Brandt, and Swings (2004) using primers Lac1 (AGCAG-TAGGGAATCTTCCA) and Lac2GC (CGCCCGC-CGCGCCCCGCGCCCGGCCCGCCGCCCCCGCCCC-ATTYCACCGCTACACATG; Walter et al, 2001). The Erec-group (Clostridial phylogenetic clusters XIVa; Collins et al, 1994) was PCR-amplified using primers Ccoc-f (AAATGACGGTACCTGACTAA; Matsuki et al, 2002) and Ccoc-r+GC (CGCCCGGGGCGCGCCCCGG-GCGGGGCGGGGGCACGGGGGGCTTTGAGTTTC-ATTCTTGCGAA), as described previously (Maukonen et al, 2006b).…”