Tetracycline-inducible shRNA targeting antisense long non-coding RNA HIF1A-AS2 represses the malignant phenotypes of bladder cancer

Chen, Mingwei; Zhuang, Cheng‐Le; Liu, Yuchen; Li, Jianfa; Dai, Fang; Xia, Ming; Zhan, Yonghao; Lin, Junhao; Chen, Zhicong; He, Anbang; Xu, Wen; Zhao, Guoping; Guo, Yinglu; Cai, Zhiming; Huang, Weiren

doi:10.1016/j.canlet.2016.03.037

Cited by 81 publications

(75 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Antisense lncRNA HIF1A-AS2 is highly expressed in gastric cancer, and its expression is correlated with TNM stage, tumor invasion, lymph node metastasis, and poor prognosis and knockdown of HIF1A-AS2 expression by siRNA could inhibit cell proliferation in vitro and tumorigenesis in vivo. [33] In addition, a recent study determined the tumor suppressor function of HIF1A-AS2 in glioblastoma multiforme [34,35] and similarly, researchers suggested that silencing HIF1A-AS2 could lead to cell proliferation inhibition, cell migration suppression, and apoptosis induction in bladder cancer cells. [35] To our knowledge, no study has explored the function of HIF1A-AS2 in BC to date.…”

Section: Discussionmentioning

confidence: 99%

“…[33] In addition, a recent study determined the tumor suppressor function of HIF1A-AS2 in glioblastoma multiforme [34,35] and similarly, researchers suggested that silencing HIF1A-AS2 could lead to cell proliferation inhibition, cell migration suppression, and apoptosis induction in bladder cancer cells. [35] To our knowledge, no study has explored the function of HIF1A-AS2 in BC to date. The present study is the first to investigate HIF1A-AS2 expression in patients with TNBC and NTNBC.…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

A three-long noncoding RNA signature as a diagnostic biomarker for differentiating between triple-negative and non-triple-negative breast cancers

2017

View full text Add to dashboard Cite

Background:Triple-negative breast cancer (TNBC) is an aggressive cancer with unfavorable outcome and it is useful to explore noninvasive biomarkers for its early diagnosis. Here, we identified differentially expressed long noncoding RNAs (lncRNAs) in blood samples of patients with TNBC to assess their diagnostic value.Methods:Differential expression of lncRNAs in plasma of patients with TNBC (n = 25) and non-TNBC (NTNBC; n = 35) and in healthy controls was compared by microarray analysis and validated by real-time PCR. lncRNA expression between plasma and BC tissues was compared using Pearson correlation test. Logit model was used to obtain a new lncRNA-based score. Receiver operating characteristic analysis was performed to assess the diagnostic value of the selected lncRNAs.Results:Microarray data showed that 41 lncRNAs were aberrantly expressed. Among these, antisense noncoding RNA in the INK4 locus (ANRIL), hypoxia inducible factor 1alpha antisense RNA-2 (HIF1A-AS2), and urothelial carcinoma-associated 1 (UCA1) were markedly upregulated in plasma of patients with TNBC compared with patients with NTNBC (P < 0.01). HIF1A-AS2 expression was positively associated with its tissue levels (r = 0.670, P < 0.01). AUC (95% CI) of ANRIL, HIF1A-AS2, and UCA1 was 0.785 (0.660–0.881), 0.739 (0.610–0.844), and 0.817 (0.696–0.905), respectively. TNBCSigLnc-3, a new score obtained using the logit model, showed excellent diagnostic performance, with AUC of 0.934 (0.839–0.982), sensitivity of 76.0%, and specificity of 97.1%.Conclusion:ANRIL, HIF1A-AS2, and UCA1 expression was significantly increased in plasma of patients with TNBC, suggesting their use as TNBC-specific diagnostic biomarkers.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

A three-long noncoding RNA signature as a diagnostic biomarker for differentiating between triple-negative and non-triple-negative breast cancers

2017

View full text Add to dashboard Cite

show abstract

“…The siRNA for control, Bax, p53, p63, p73, and HMGA1 was pool obtained from Thermo Fisher Scientific (217319). The HIF1A‐AS2 siRNA sequence (GAGUUGGAGGUGUUGAAGCAAAUAU) and pcDNA3.1‐HIF1A‐AS2 was ordered from GenePharma (Suzhou, China) . For Bax luciferase assay, the pGL3‐Bax reporter plasmid was constructed as previous described …”

Section: Methodsmentioning

confidence: 99%

“…Real‐time quantitative polymerase chain reactions (RT‐PCRs) for HIF1A‐AS2, Bax, PUMA, Bim, Noxa, HMGA1, and β‐actin were performed with SYBR Green Super Mixture Reagents (Bio‐Rad) on the CFX connect real‐time system (Bio‐Rad). The PCR primer sequences were used as previous described …”

Section: Methodsmentioning

confidence: 99%

The long noncoding RNA HIF1A‐AS2 facilitates cisplatin resistance in bladder cancer

Chen

Liu

Meng

et al. 2018

J of Cellular Biochemistry

View full text Add to dashboard Cite

Chemotherapy drug resistance frequently happens in more than 50% of bladder cancer patients and is the major obstacle for the bladder cancer therapy. Recent studies have shown that long noncoding RNA (lncRNA) is involved in the development of chemoresistance. In this study, we reported hypoxia inducible factor 1α-antisense RNA 2 (HIF1A-AS2), as a subtype-specific hypoxia inducible lncRNA, is upregulated in bladder cancer cells and tissue after cisplatin (Cis) treatment. The induction of HIF1A-AS2 in bladder cancer cells rendered resistance to Cis-induced apoptosis. Silencing HIF1A-AS2 in Cis-resistant bladder cancer cells was re-sensitized to Cis-induced apoptosis. Mechanically, we found that HIF1A-AS2 suppressed the transcription activity of p53 family proteins by promoting the expression of high-mobility group A1 (HMGA1). The induction of HMGA1 physically interacts with p53, p63, and p73, and therefore constrains their transcriptional activity on Bax. Knockdown of HIF1A-AS2 or HMGA1 rescued the expression of Bax, which therefore enhanced the killing effect of Cis. Furthermore, we also found that the expression of HIF1A-AS2 was higher in the human bladder tumor tissues after Cis treatment, and was positive correlated to the expression of HIF1α and HMGA1. This study suggests that upregulated HIF1A-AS2 hampers the p53 family proteins dependent apoptotic pathway to promote Cis resistance in bladder cancer. Our data suggested that HIF1A-AS2 plays oncogenic roles and can be used as a therapeutic target for treating human bladder cancer.

show abstract

“…Elevated expression of ANRIL [15], SChLAP1 [16], HIF1A-AS2 [17], BC072678 [18], PCAT1 [19], TINCR [20], MALAT1 [21], TUG1 [22] in MIBC was confirmed in the MiTranscriptome analysis, however with much lower fold changes than was found for CAT266 , CAT1297 and CAT1647 (Figure 2D, Supplementary Table 4). …”

Section: Resultsmentioning

confidence: 93%

Identification of long non-coding RNAs that stimulate cell survival in bladder cancer

et al. 2017

View full text Add to dashboard Cite

For many years, research on the biology underlying bladder cancer focused on protein-coding genes which cover only about 3% of the human genome. Recently, it was discovered that a large part of the human genome is actively transcribed as long non-coding RNAs (lncRNAs). LncRNAs are master regulators of gene expression and several lncRNAs were shown to play a role in bladder cancer development and progression. Here, we analyzed lncRNA expression in muscle-invasive bladder cancer (MIBC) using the MiTranscriptome database of cancer lncRNA expression profiles, and we studied their function in bladder cancer-derived tumor cells. Analysis of the MiTranscriptome lncRNA expression data revealed four MIBC subgroups, which partially overlapped with the four mRNA clusters identified by The Cancer Genome Atlas consortium. Up-regulation of three lncRNAs CAT266, CAT1297, and CAT1647 in bladder cancer, in comparison to normal urothelium, was confirmed in an independent series of normal, non-muscle invasive (NMIBC) and MIBC tissue samples. Furthermore, expression levels of CAT1297 were found to be correlated with disease-free and overall survival in MIBC. Knockdown of CAT266, CAT1297, and CAT1647 decreased cell viability and colony formation, due to the induction of apoptosis. In conclusion, our data show that lncRNAs expression is de-regulated in MIBC and three aberrantly expressed transcripts regulate proliferation and apoptosis. Our data indicate that lncRNAs play an important role in MIBC development and progression and are a treasure chest for the discovery of new biomarkers.

show abstract

Tetracycline-inducible shRNA targeting antisense long non-coding RNA HIF1A-AS2 represses the malignant phenotypes of bladder cancer

Cited by 81 publications

References 36 publications

A three-long noncoding RNA signature as a diagnostic biomarker for differentiating between triple-negative and non-triple-negative breast cancers

A three-long noncoding RNA signature as a diagnostic biomarker for differentiating between triple-negative and non-triple-negative breast cancers

The long noncoding RNA HIF1A‐AS2 facilitates cisplatin resistance in bladder cancer

Identification of long non-coding RNAs that stimulate cell survival in bladder cancer

Contact Info

Product

Resources

About