The 28.5-kDa iron-sulfur protein of mitochondrial complex I is encoded in the nucleus in plants

Abstract

The intrinsic 28.5-kDa iron-sulfur protein of complex I in the mitochondrial respiratory chain is encoded in the nucleus in animals and fungi, but specified by a mitochondrial gene in trypanosomes. In plants, the homologous protein is now found to be encoded by a single-copy nuclear gene in Arabidopsis thaliana and by two nuclear genes in potato. The cysteine motifs involved in binding two iron-sulfur clusters are conserved in the plant protein sequences. The locations of the seven introns, with sizes between 60 and 1700 nucleotides, are identical in the A. thaliana and the two potato genes, while their primary sequences diverge considerably. The A + T contents of the intron sequences range between 61% and 73%, as is characteristic for dicot plants, but are in some instances not higher than in the adjacent exons. Here, differences in T content may instead serve to discriminate exons and introns. In potato, both genes are expressed, with the highest levels found in flowers. Sequence similarities between the homologous nuclear and mitochondrial genes indicate that the nuclear forms in animals and plants originate from the endosymbiont genome.

Identification of a mitochondrial external NADPH dehydrogenase by overexpression in transgenic Nicotiana sylvestris

“…The low signal detected, probably because of imperfect fit between the N. sylvestris sequence and the potato primers, indicates that the quantification was not perturbed by the expression of an endogenous NADPH dehydrogenase gene. The 28.5 kDa subunit of tobacco complex I (Schmidt‐Bleek et al ., 1997) was used as control, showing similar transcript levels in transformants and WT plants.…”

“…(2002). The primer sequences used for real time PCR were for St‐ NDB1: 5′‐AGAGCGAAGGACCAACCTCC‐3′, 5′‐ACAACCCTTCACTCGCAACC‐3′, and for the N. tabacum 28.5 kDa subunit of complex I (Accession number ; Schmidt‐Bleek et al ., 1997): 5′‐TCGTCAGCTTGTTTTGCCAG‐3′, 5′‐GGCTTCTTGGCAGAATCCAC‐3′. RT‐PCR for screening of transgenic lines was performed using primers St‐ – S1: 5′‐GCATAGTAGAGCCGGTTCGG‐3′, 5′‐TTTCCTGGCCAACTTGTTCC‐3′.…”

“…Total leaf RNA isolation, cDNA synthesis, and real time RT-PCR were carried out as previously described by Svensson et al (2002). The primer sequences used for real time PCR were for St-NDB1: 5 H -AGAGCGAAGGACCAACCTCC-3 H , 5 H -ACAACCCTT-CACTCGCAACC-3 H , and for the N. tabacum 28.5 kDa subunit of complex I (Accession number Y09109; Schmidt-Bleek et al, 1997): 5 H -TCGTCAGCTTGTTTTGCCAG-3 H , 5 H -GGCTTCTTGGCAGAATC-CAC-3 H . RT-PCR for screening of transgenic lines was performed using primers St-NDB1 ± S1: 5 H -GCATAGTAGAGCCGGTTCGG-3 H , 5 H -TTTCCTGGCCAACTTGTTCC-3 H .…”

Promoters of nuclear‐encoded respiratory chain Complex I genes from Arabidopsis thaliana contain a region essential for anther/pollen‐specific expression

“…The high degree of structural conservation of the iron-sulphur and NADH-binding protein subunits between bacteria, protozoa, fungi and mammals suggests these proteins are essential components for a functional respiratory chain. For plants, genes coding for three of these central intrinsic subunits have recently been identified Heiser et al, 1996;Schmidt-Bleek et al, 1997). These plant homologues for the mammalian 51 kDa subunit (the NADH-binding protein, 55 kDa) and two intrinsic ironsulphur proteins (PSST, 22 kDa and TYKY, 28 kDa) are encoded by nuclear genes (nuclear-encoded Complex I genes, nCI genes).…”

Characterization of two cDNA clones encoding isozymes of the F1F0-ATPase inhibitor protein of rice mitochondria

“…In mature rice plants, high relative amounts of IF 1 -1 and IF 1 -2 transcripts were detected in the young panicles and the panicles after heading in comparison with in the leaf blades and leaf sheaths. High levels of expression in¯owers (panicles) have been observed for the genes coding the mitochondrial respiratory proteins in other plant species such as tobacco, potato, sun¯ower and Arabidopsis thaliana (Huang et al 1994;Smart et al 1994;Heiser et al 1996;Schmidt-Bleek et al 1997) as well as rice (Ohtsu et al 1999). Based on these ®ndings, it has been suggested that the energy produced by the mitochondrial oxidative phosphorylation is needed during the generative¯oral life cycle.…”