The Adenosine 2b Receptor Is Recruited to the Plasma Membrane and Associates with E3KARP and Ezrin upon Agonist Stimulation

Abstract

We have previously shown that adenosine is formed in the intestinal lumen during active inflammation from neutrophil-derived 5-AMP. Acting through the adenosine A2b receptor (A2bR), the luminally derived adenosine induces vectorial chloride secretion and a polarized secretion of interleukin-6 to the intestinal lumen. Although some G protein-coupled receptors interact with anchoring or signaling molecules, not much is known in this critical area for the A2bR. We used the model intestinal epithelial cell line, T84, and Caco2-BBE cells stably transfected with GFP-A2b receptor to study the intestinal A2bR. The A2bR is present in both the apical and basolateral membranes of intestinal epithelia. Apical or basolateral stimulation of the A2bR induces recruitment of the receptor to the plasma membrane and caveolar fractions. The A2bR co-immunoprecipitates with E3KARP and ezrin upon agonist stimulation. Ezrin interacts with E3KARP and PKA and the interaction between ezrin and E3KARP is enhanced by agonist stimulation. Our data suggest that the A2bR is recruited to the plasma membrane upon apical or basolateral agonist stimulation and interacts with E3KARP and ezrin. We speculate that such an interaction may not only anchor the A2bR to the plasma membrane but may also function to stabilize the receptor in a signaling complex in the plasma membrane.

Adenosine receptor A2b on hematopoietic cells mediates LPS-induced migration of PMNs into the lung interstitium

“…In the same model, a systemic Salmonella infection was aggravated in A 2b Ϫ/Ϫ mice. The authors explained their findings of pro-and anti-inflammatory effects of A 2b by potential existence of A 2b in a multiprotein complex (20,22,47), where diverse interactions may lead to different functional effects. Another possible explanation for the antipodal effects of A 2b could be different reactions of the receptor on chronic elevation of adenosine levels in chronic diseases or rapid elevation in an acute setting (46).…”

Effect of A2B Adenosine Receptor Gene Ablation on Proinflammatory Adenosine Signaling in Mast Cells

“…An alternative and more likely explanation of this phenomenon could be that the A 2B receptor protein interacts with other signaling pathways unrelated to adenosine. Recent evidence suggests that adenosine receptors play a role in assembly of multiprotein signaling complexes (57)(58)(59)(60)(61). Rearrangement of proteins normally coupled to the A 2B receptor as a result of the A 2B KO may affect FcRI-dependent regulation of degranulation.…”

Klotho-related Protein Is a Novel Cytosolic Neutral β-Glycosylceramidase

“…Two sets of siRNA corresponding to the sequences of the 332-nucleotide (siRNA-332) GGGTTACTCCCATTGTGACCCTCTA and the 564-nucleotide (siRNA-564) TGGAGGTTATCAGGCAGCTCATAAT, from the initiation codon of KLrP cDNA, were used. BLOCK-iT Fluorescent Oligo (Invitrogen), a fluorescence-labeled, double-stranded RNA duplex with the same length, charge, and configuration as standard siRNA, was used as a control siRNA (19,20). HEK293 cells were transfected with the siRNA using Oligofectamine TM reagent (Invitrogen) according to the instructions of the manufacturer.…”