The C-terminal proteolytic processing of extracellular superoxide dismutase is redox regulated

Gottfredsen, Randi H.; Tran, Sophie My-Hang; Larsen, Ulrike G.; Madsen, Peder; Nielsen, Morten S.; Enghild, Jan J.; Petersen, Steen V.

doi:10.1016/j.freeradbiomed.2011.10.443

Cited by 16 publications

(9 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The sequence encoding full-length EC-SOD with an optimized Kozak sequence was previously established in the pIRES vector [25]. The Pro112Ala substitution was introduced by PCR using the Quick change site-directed mutagenesis kit provided by Stratagene and the sequence of the obtained expression plasmid was verified by sequencing.…”

Section: Methodsmentioning

confidence: 99%

“…The Pro112Ala substitution was introduced by PCR using the Quick change site-directed mutagenesis kit provided by Stratagene and the sequence of the obtained expression plasmid was verified by sequencing. HEK293 cells were stably transfected as previously described and protein expression conducted in serum-free medium [25]. The expressed P112A EC-SOD was active as evaluated by using the cytochrome C assay (see below) and activity staining [24] indicating that the protein was folded correctly.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Hydrogen peroxide induce modifications of human extracellular superoxide dismutase that results in enzyme inhibition

et al. 2013

Self Cite

View full text Add to dashboard Cite

Superoxide dismutase (EC-SOD) controls the level of superoxide in the extracellular space by catalyzing the dismutation of superoxide into hydrogen peroxide and molecular oxygen. In addition, the enzyme reacts with hydrogen peroxide in a peroxidase reaction which is known to disrupt enzymatic activity. Here, we show that the peroxidase reaction supports a site-specific bond cleavage. Analyses by peptide mapping and mass spectrometry shows that oxidation of Pro112 supports the cleavage of the Pro112–His113 peptide bond. Substitution of Ala for Pro112 did not inhibit fragmentation, indicating that the oxidative fragmentation at this position is dictated by spatial organization and not by side-chain specificity. The major part of EC-SOD inhibited by the peroxidase reaction was not fragmented but found to encompass oxidations of histidine residues involved in the coordination of copper (His98 and His163). These oxidations are likely to support the dissociation of copper from the active site and thus loss of enzymatic activity. Homologous modifications have also been described for the intracellular isozyme, Cu/Zn-SOD, reflecting the almost identical structures of the active site within these enzymes. We speculate that the inactivation of EC-SOD by peroxidase activity plays a role in regulating SOD activity in vivo, as even low levels of superoxide will allow for the peroxidase reaction to occur.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Hydrogen peroxide induce modifications of human extracellular superoxide dismutase that results in enzyme inhibition

et al. 2013

Self Cite

View full text Add to dashboard Cite

show abstract

“…Because the mature protein is a tetramer, this event supports the formation of mature EC-SOD with modulated ECM-binding capacity depending on the ratio of intact and cleaved subunits within the tetramer [5,12]. We have recently provided evidence that the proteolytic processing of the EC-SOD subunit is subject to redox control and argued that this type of regulation dictates the variable ratios of intact and cleaved subunits observed in EC-SOD extracted from different tissues [19,22]. …”

mentioning

confidence: 89%

The cellular distribution of extracellular superoxide dismutase in macrophages is altered by cellular activation but unaffected by the naturally occurring R213G substitution

Gottfredsen

Goldstrohm

Hartney

et al. 2014

Free Radical Biology and Medicine

Self Cite

View full text Add to dashboard Cite

Extracellular superoxide dismutase (EC-SOD) is responsible for the dismutation of the superoxide radical produced in the extracellular space and known to be expressed by inflammatory cells, including macrophages and neutrophils. Here we show that EC-SOD is produced by resting macrophages and associated with the cell surface via the extracellular matrix (ECM)-binding region. Upon cellular activation induced by lipopolysaccharide, EC-SOD is relocated and detected both in the cell culture medium and in lipid raft structures. Although the secreted material presented a significantly reduced ligand-binding capacity, this could not be correlated to proteolytic removal of the ECM-binding region, because the integrity of the material recovered from the medium was comparable to that of the cell surface-associated protein. The naturally occurring R213G amino acid substitution located in the ECM-binding region of EC-SOD is known to affect the binding characteristics of the protein. However, the analysis of macrophages expressing R213G EC-SOD did not present evidence of an altered cellular distribution. Our results suggest that EC-SOD plays a dynamic role in the inflammatory response mounted by activated macrophages.

show abstract

“…Proteins: Recombinant wild-type SOD3 and SOD3 containing a C -terminal c-Myc tag (SOD3-cMyc) was produced as previously described [42]. For the generation of the SOD3-cMyc expression plasmid, we used the forward primer (5′-TATACAGCTAGCATGCTGGCGCTACTGTGTTCC-3′) and a reverse primer encompassing the cMyc tag (underlined) (5′-TATGAATTCT CACAGATCCTCTTCTGAGATGAGTTTTTGTTCG GCGGCCTTGCACTCGCTCTC-3′) and cloned the product into the pIRES vector.…”

Section: Methodsmentioning

confidence: 99%

The dynamic uptake and release of SOD3 from intracellular stores in macrophages modulates the inflammatory response

Zachariae

Larsen

et al. 2019

Redox Biology

Self Cite

View full text Add to dashboard Cite

Superoxide dismutase 3 (SOD3) is an extracellular enzyme with the capacity to modulate extracellular redox conditions by catalyzing the dismutation of superoxide to hydrogen peroxide. In addition to synthesis and release of this extracellular protein via the secretory pathway, several studies have shown that the protein also localizes to intracellular compartments in neutrophils and macrophages. Here we show that human macrophages release SOD3 from an intracellular compartment within 30 min following LPS stimulation. This release acutely increases the level of SOD3 on the cell surface as well as in the extracellular environment. Generation of the intracellular compartment in macrophages is supported by endocytosis of extracellular SOD3 via the LDL receptor-related protein 1 (LRP1). Using bone marrow-derived macrophages established from wild-type and SOD3 −/− mice, we further show that the pro-inflammatory profile established in LPS-stimulated cells is altered in the absence of SOD3, suggesting that the active release of this protein affects the inflammatory response. The internalization and acute release from stimulated macrophages indicates that SOD3 not only functions as a passive antioxidant in the extracellular environment, but also plays an active role in modulating redox signaling to support biological responses.

show abstract

The C-terminal proteolytic processing of extracellular superoxide dismutase is redox regulated

Cited by 16 publications

References 44 publications

Hydrogen peroxide induce modifications of human extracellular superoxide dismutase that results in enzyme inhibition

Hydrogen peroxide induce modifications of human extracellular superoxide dismutase that results in enzyme inhibition

The cellular distribution of extracellular superoxide dismutase in macrophages is altered by cellular activation but unaffected by the naturally occurring R213G substitution

The dynamic uptake and release of SOD3 from intracellular stores in macrophages modulates the inflammatory response

Contact Info

Product

Resources

About