The catalytic domain of a Piromyces rhizinflata cellulase expressed in Escherichia coli was stabilized by the linker peptide of the enzyme

Liu, Jinhao; Tsai, Cheng-Fang; Liu, Jui-Wen; Cheng, K.-J.; Cheng, Chih-Ling

doi:10.1016/s0141-0229(00)00349-5

Cited by 33 publications

(17 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Interestingly, the extracellular ␤-glucanase activity of L. reuteri pNZJ068(eglA) was much higher than that of L. reuteri pNZJ023(glu) or those in previous studies in which the bacterial ␤-glucanase gene was transformed into Lactobacillus. Liu et al (22) reported that the cellulase gene eglA also had xylanase activity. However, the xylanase activity of L. reuteri pNZJ068(eglA) was not detectable in this study.…”

Section: Discussionmentioning

confidence: 99%

“…The primers 23F (5Ј GCAGTCGACCGTTAG CGCAAAGG 3Ј) and 23R (5Ј TTCCTGCAGTCACGATTGCGGAG 3Ј) were used to amplify the F. succinogenes ␤-glucanase gene (GenBank accession number M33676) in pJI10 (16). The primers 68F (5Ј GCAGTCGACATGATCCGT GATATTT 3Ј) and 68R (5Ј TTCCTGCAGTTATTCCTCTGTTTCTT 3Ј) were employed to amplify the P. rhizinflata cellulase gene eglA (GenBank accession number AF094757) in pGEX-EGLA (22). These primers were designed to place a SalI site (underlined) at the 5Ј end and a PstI site (underlined) at the 3Ј end of the PCR product, respectively.…”

Section: Methodsmentioning

confidence: 99%

“…In a previous study, we reported isolation of a cellulase gene, eglA, from the ruminal fungus Piromyces rhizinflata. The cellulase gene eglA showed carboxymethyl cellulase (CMCase), ␤-glucanase, and xylanase activity amounting to 345, 576, and 106 units per mg of protein, respectively (22). We also reported isolation of a xylanase gene from the ruminal fungus Neocallimastix patriciarum strain 27 and used site-directed mutagenesis to produce a thermostable and alkalophilic mutant xylanase gene (xynCDBFV).…”

mentioning

confidence: 99%

See 2 more Smart Citations

Expression of Rumen Microbial Fibrolytic Enzyme Genes in Probiotic Lactobacillus reuteri

Liu

et al. 2005

Appl Environ Microbiol

Self Cite

View full text Add to dashboard Cite

This study was aimed at evaluating the cloning and expression of three rumen microbial fibrolytic enzyme genes in a strain of Lactobacillus reuteri and investigating the probiotic characteristics of these genetically modified lactobacilli. The Neocallimastix patriciarum xylanase gene xynCDBFV, the Fibrobacter succinogenes ␤-glucanase (1,3-1,4-␤-D-glucan 4-glucanohydrolase [EC 3.2.1.73]) gene, and the Piromyces rhizinflata cellulase gene eglA were cloned in a strain of L. reuteri isolated from the gastrointestinal tract of broilers. The enzymes were expressed and secreted under the control of the Lactococcus lactis lacA promoter and its secretion signal. The L. reuteri transformed strains not only acquired the capacity to break down soluble carboxymethyl cellulose, ␤-glucan, or xylan but also showed high adhesion efficiency to mucin and mucus and resistance to bile salt and acid.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

mentioning

confidence: 99%

See 1 more Smart Citation

Expression of Rumen Microbial Fibrolytic Enzyme Genes in Probiotic Lactobacillus reuteri

Liu

et al. 2005

Appl Environ Microbiol

Self Cite

View full text Add to dashboard Cite

show abstract

“…Peptide chain extensions are the process of elongating the polypeptide chain of the enzyme on either the N terminus or the C terminus end. This has been shown to improve temperature stability of proteins (3,4). It is not frequently done for biotechnology applications other than improving stability, but it can be effective.…”

Section: Introductionmentioning

confidence: 99%

Introduction to the Field of Enzyme Immobilization and Stabilization

Moehlenbrock

Minteer

2010

Enzyme Stabilization and Immobilization

View full text Add to dashboard Cite

Enzyme stabilization is important for any biomedical or industrial application of enzymes. In many applications, the goal is to provide extended active lifetime at normal environmental conditions with traditional substrates at low concentrations in buffered solutions. However, as enzymes are used for more and more applications, there is a desire to use them in extreme environmental conditions (i.e., high temperatures), in high substrate concentration, and in nontraditional solvent systems. This chapter introduces the topic of enzyme stabilization and the methods used for enzyme stabilization including enzyme immobilization.

show abstract

“…The untreated control plate was incubated on ice. Enzyme assays were done essentially as described previously 5) except that 96-well PCR microtiter plates were used in this study. To start the reaction, 40 ml of 0.8z b-glucan was added to the cell culture.…”

mentioning

confidence: 99%

A Variant ofOrpinomyces joyonii1,3-1,4-β-Glucanase with Increased Thermal Stability Obtained by Random Mutagenesis and Screening

Kim¹,

Cheng²,

Liu³

2002

Bioscience, Biotechnology, and Biochemistry

Self Cite

View full text Add to dashboard Cite

The catalytic domain of a Piromyces rhizinflata cellulase expressed in Escherichia coli was stabilized by the linker peptide of the enzyme

Cited by 33 publications

References 24 publications

Expression of Rumen Microbial Fibrolytic Enzyme Genes in Probiotic Lactobacillus reuteri

Expression of Rumen Microbial Fibrolytic Enzyme Genes in Probiotic Lactobacillus reuteri

Introduction to the Field of Enzyme Immobilization and Stabilization

A Variant ofOrpinomyces joyonii1,3-1,4-β-Glucanase with Increased Thermal Stability Obtained by Random Mutagenesis and Screening

Contact Info

Product

Resources

About